Associative transcriptomics study dissects the genetic architecture of seed glucosinolate content in Brassica napus

Abstract

Breeding new varieties with low seed glucosinolate (GS) concentrations has long been a prime target in Brassica napus. In this study, a novel association mapping methodology termed 'associative transcriptomics' (AT) was applied to a panel of 101 B. napus lines to define genetic regions and also candidate genes controlling total seed GS contents. Over 100,000 informative single-nucleotide polymorphisms (SNPs) and gene expression markers (GEMs) were developed for AT analysis, which led to the identification of 10 SNP and 7 GEM association peaks. Within these peaks, 26 genes were inferred to be involved in GS biosynthesis. A weighted gene co-expression network analysis provided additional 40 candidate genes. The transcript abundance in leaves of two candidate genes, BnaA.GTR2a located on chromosome A2 and BnaC.HAG3b on C9, was correlated with seed GS content, explaining 18.8 and 16.8% of phenotypic variation, respectively. Resequencing of genomic regions revealed six new SNPs in BnaA.GTR2a and four insertions or deletions in BnaC.HAG3b. These deletion polymorphisms were then successfully converted into polymerase chain reaction-based diagnostic markers that can, due to high linkage disequilibrium observed in these regions of the genome, be used for marker-assisted breeding for low seed GS lines.

Keywords: GEM; SNP; associative transcriptomics; glucosinolate.

Figure 1.

Frequency distribution of total seed glucosinolate concentrations in the diversity panel.

Figure 2.

Associative transcriptomics for seed glucosinolate content. These plots are based on the association results in 101 lines using either 144,131 SNPs or 100,534 GEMs. Each dot represents a SNP (black) or a GEM (red). Blue bar beneath chromosome pseudomolecule indicates the confident interval of a QTL for total seed glucosinolate content reported.

Figure 3.

Associations and genomic locations of two candidate genes for the seed glucosinolate content. Top, marker association scans are illustrated, for both SNP (black dot) and GEM (red dot) markers, with significance of association (as −log₁₀P values) plotted against positions within a specific chromosome pseudomolecule. Bottom, a representation of the pairwise r² (a measure of LD) among the mapped SNPs surrounding the peak, where the colour of each box corresponds to the r² value according to the legend. The positions of the candidate genes are indicated by arrows. (a) A locus identified on A2, and (b) A locus identified on C9.

Figure 4.

Summary of significant polymorphisms at BnaC.HAG3b locus. The locations of DNA sequence polymorphisms (in bp) are based on unigene EX043693. All four polymorphisms were combined into two haplotypes. The number of lines sharing each haplotype, as well as the glucosinolate content (mean±standard error) was given at the right. **indicates the statistical difference at P < 0.01 in t-test. Arrows indicate the positions of primers (260F: TTGTAATAGAGTTCATATATATCG; 490R: TTCATACATCAAATACCAAAC) for the converted PCR marker.

Figure 5.

PCR assay for the 11-bp deletions at BnaC.HAG3b locus. PCR primer combination 260F/490R was used, which produced a 226-bp (haplotype I) or 237-bp (haplotype II) band. Numbers on the left and right sides are fragment length in base pair. M, 100-bp DNA ladder.