Identification of a novel RNA virus lethal to tilapia

Abstract

Tilapines are important for the sustainability of ecological systems and serve as the second most important group of farmed fish worldwide. Significant mortality of wild and cultured tilapia has been observed recently in Israel. The etiological agent of this disease, a novel RNA virus, is described here, and procedures allowing its isolation and detection are revealed. The virus, denominated tilapia lake virus (TiLV), was propagated in primary tilapia brain cells or in an E-11 cell line, and it induced a cytopathic effect at 5 to 10 days postinfection. Electron microscopy revealed enveloped icosahedral particles of 55 to 75 nm. Low-passage TiLV, injected intraperitoneally in tilapia, induced a disease resembling the natural disease, which typically presents with lethargy, ocular alterations, and skin erosions, with >80% mortality. Histological changes included congestion of the internal organs (kidneys and brain) with foci of gliosis and perivascular cuffing of lymphocytes in the brain cortex; ocular inflammation included endophthalmitis and cataractous changes of the lens. The cohabitation of healthy and diseased fish demonstrated that the disease is contagious and that mortalities (80 to 100%) occur within a few days. Fish surviving the initial mortality were immune to further TiLV infections, suggesting the mounting of a protective immune response. Screening cDNA libraries identified a TiLV-specific sequence, allowing the design of a PCR-based diagnostic test. This test enables the specific identification of TiLV in tilapines and should help control the spread of this virus worldwide.

FIG 1

Characteristics of tilapia disease and pathological findings. Tilapia disease in commercial hybrid tilapia (O. niloticus × O. aureus hybrid) (A and C to E) and in wild tilapia (S. galilaeus) from the Sea of Galilee (B and F to H). (A) Tilapia disease outbreak in a commercial pond results in massive mortality (August 2013; courtesy of Nathan Wajsbrut). (B) Diseased tilapia demonstrating shrinkage of the eye and loss of ocular functioning (phthisis bulbi). (C) Gross pathology of skin includes multifocal to coalescing dermal erosions and ulcers (arrowheads; courtesy of Nathan Wajsbrut). (D) Kidney and interstitium. The arrowheads mark a dilated vein packed with large numbers of red blood cells (congestion). Hematoxylin and eosin (H&E) stain ×10. (E) Brain and cortex. The arrowheads mark dilated blood vessels packed with large numbers of red blood cells within the leptomeninges and gray and white matter. H&E stain ×10 was used. (F) Brain and cortex. Perivascular cuffs of lymphocytes (encircled). H&E stain ×40 was used. (Ga) Lens. Cataractous changes characterized by formation of eosinophilic spherical structures (morgagnian globules) accompanied by degeneration of crystalline fibers (encircled). H&E stain ×10 was used. (Gb) Control lens from healthy fish. H&E stain ×10 was used. (H) Eye and cornea. Loss of integrity of the overlying squamous epithelium with inflammatory infiltrate (arrowheads) and multiple capillaries within the stroma (neovascularization; encircled). The collagen fibers within the superficial stroma are smudged and are stained pale eosinophilic (corneal edema). H&E stain ×10 was used.

FIG 2

CPE induction in infected cultures and EM analyses. (A) E-11 infected cells. CPE (at day 5 postinoculation). Plaque formation and vacuolated cells at the rims of the plaques. The centers of two plaques are marked with asterisks. (B) Infected primary tilapia brain cells. CPE (at day 10 postinoculation). Conversion of the typical elongated cells into swollen, rounded, and granulated cells (marked with arrows). Mock-infected E-11 (C) or primary tilapia brain (D) cells. (E and F) Transmission EM of thin sections of infected E-11 cells revealed the presence of cytoplasmic particles (diameter, 55 to 60 nm) aggregated (E; marked with an arrow) or not (F) within a membrane. Scale bars, 200 and 500 nm for (E) and (F), respectively. (G) EM of negatively stained virions, pelleted from infected E11 culture supernatants. Scale bar, 100 nm.

FIG 3

Sequence and PCR detection of TiLV. (A) Shotgun, 5′, and 3′ RACE methodologies were used to clone and sequence a portion of TiLV. Shown are the 1,326 bases of clone 7450 (GenBank accession no. KJ605629), which contains an open reading frame (underlined). The putative translation product (420 amino acids [aa]) of this open frame is shown at the bottom, in a single-letter code. The primer binding sites are shown in bold (for PCR amplification of a 250-bp fragment) or in bold and italic letters (for PCR amplification of a 491-bp fragment). (B) Detection of TiLV by PCR. Total RNA was extracted from brains of TiLV-infected fish (lanes 1 to 7) and a healthy fish (lane 10), as well as from E-11 and primary tilapia brain infected cell cultures (lanes 8 and 9, respectively), and was used as a template for cDNA generation. A 250-bp fragment was amplified with the ME1 (GTTGGGCACAAGGCATCCTA) and clone 7450/150R/ME2 (TATCACGTGCGTACTCGTTCAGT) primers. (C) Reverse transcription is required for PCR amplification of TiLV. Total RNA was extracted from the supernatant (lanes 1 and 2) or from cell extracts (lanes 3 and 4) of TiLV-infected E-11 culture, or from naive E-11 culture (lanes 5 and 6). The samples were not treated with DNase, and reverse transcription was carried out (+) or not (−) prior to the PCR step. A “no RNA” negative control (lane 7) was also included. A 491-bp fragment was amplified with the primers Nested ext-1 (TATGCAGTACTTTCCCTGCC) and Nested ext-2 (TTGCTCTGAGCAAGAGTACC). (D) Nuclease sensitivity assays. Nuclease-protected nucleic acids were extracted from purified virions and were treated (+) or not (−) with reverse transcriptase and/or RNase I prior to PCR amplification with TiLV-specific primers (Nested ext-1 [TATGCAGTACTTTCCCTGCC] and Nested ext-2 [TTGCTCTGAGCAAGAGTACC]; amplified product, 491 bp) or SnRV-specific primers (Snakehead gag-pol fw [CAGATCACTGATCGATGC] and Snakehead gag-pol rev [GTCTGAAAGGTAAGGTGG]; amplified product, 284 bp). M, the DNA size marker (B to D).

FIG 4

Kinetics of TiLV-induced mortality. Fish were divided into groups of 30 SPF fish. Groups 1 (◆) and 2 (▲) were infected by i.p. injection or cohabitation, respectively. The control group (●) was composed of an identical number of fish inoculated with the supernatants of naive E-11 cultures. Variability between the three experimental groups was determined by chi-square tests, in which a P value of <0.05 was considered significant. Bars represent standard errors.