Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Case Reports
. 2014 Dec;58(12):7548-52.
doi: 10.1128/AAC.03911-14. Epub 2014 Sep 22.

blaNDM-5 carried by an IncX3 plasmid in Escherichia coli sequence type 167

Ping Yang  1 , Yi Xie  2 , Ping Feng  3 , Zhiyong Zong  4
Affiliations
Case Reports

blaNDM-5 carried by an IncX3 plasmid in Escherichia coli sequence type 167

Ping Yang et al. Antimicrob Agents Chemother. 2014 Dec.

Abstract

bla(NDM-)5 was found in Escherichia coli strain 0215 from a Chinese patient without travel history. Genomic sequencing and conjugation experiments were performed. Strain 0215 belonged to sequence type 167 (ST167) and had other resistance determinants, including bla(TEM-135), bla(CTX-M-14), and aac(6')-Ib. bla(NDM-5) was carried by a 47-kb self-transmissible IncX3 plasmid and was in a complex genetic context similar to that of bla(NDM-1) on IncX3 plasmids. IncX3 plasmids might have emerged as a common vehicle mediating the spread of bla(NDM).

PubMed Disclaimer

Figures

FIG 1
FIG 1
Genetic contexts of blaNDM-1 and blaNDM-5 on IncX3 plasmids. Plasmid names of each structure and their GenBank accession numbers are listed. The identical regions are highlighted in gray. The 4-bp flanking sequences of each IS5 are shown. Between mpr and ISSwil, there are several ORFs of unknown function, which are indicated here by “several orfs.” Two long-range PCR products used to fill in the gap of pNDM5_0215 are shown by lines, and primer names and amplicon sizes are indicated. Primers NDM-F1 and NDM-R1 are from reference , while primers 0215-2 (TGGTGCTGGTTATCTGTGCT) and parA_pMGR194-R1 (CCGTTATCTGTCCGCTTTTC) were newly designed.
See this image and copyright information in PMC

References

    1. Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, Krishnan P, Kumar AV, Maharjan S, Mushtaq S, Noorie T, Paterson DL, Pearson A, Perry C, Pike R, Rao B, Ray U, Sarma JB, Sharma M, Sheridan E, Thirunarayan MA, Turton J, Upadhyay S, Warner M, Welfare W, Livermore DM, Woodford N. 2010. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect. Dis. 10:597–602. 10.1016/S1473-3099(10)70143-2. - DOI - PMC - PubMed
    1. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, Walsh TR. 2009. Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob. Agents Chemother. 53:5046–5054. 10.1128/AAC.00774-09. - DOI - PMC - PubMed
    1. Hornsey M, Phee L, Wareham DW. 2011. A novel variant, NDM-5, of the New Delhi metallo-β-lactamase in a multidrug-resistant Escherichia coli ST648 isolate recovered from a patient in the United Kingdom. Antimicrob. Agents Chemother. 55:5952–5954. 10.1128/AAC.05108-11. - DOI - PMC - PubMed
    1. Lane DJ. 1991. 16S/23S rRNA sequencing, p 115–175 In Stackebrant E, Goodfellow M. (ed), Nucleic acid techniques in bacterial systematics. John Wiley & Sons, New York, NY.
    1. Clinical and Laboratory Standards Institute. 2013. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. M100-S23 Clinical and Laboratory Standards Institute, Wayne, PA.

Publication types

MeSH terms

Associated data

LinkOut - more resources