Local melatoninergic system as the protector of skin integrity

Abstract

The human skin is not only a target for the protective actions of melatonin, but also a site of melatonin synthesis and metabolism, suggesting an important role for a local melatoninergic system in protection against ultraviolet radiation (UVR) induced damages. While melatonin exerts many effects on cell physiology and tissue homeostasis via membrane bound melatonin receptors, the strong protective effects of melatonin against the UVR-induced skin damage including DNA repair/protection seen at its high (pharmocological) concentrations indicate that these are mainly mediated through receptor-independent mechanisms or perhaps through activation of putative melatonin nuclear receptors. The destructive effects of the UVR are significantly counteracted or modulated by melatonin in the context of a complex intracutaneous melatoninergic anti-oxidative system with UVR-enhanced or UVR-independent melatonin metabolites. Therefore, endogenous intracutaneous melatonin production, together with topically-applied exogenous melatonin or metabolites would be expected to represent one of the most potent anti-oxidative defense systems against the UV-induced damage to the skin. In summary, we propose that melatonin can be exploited therapeutically as a protective agent or as a survival factor with anti-genotoxic properties or as a "guardian" of the genome and cellular integrity with clinical applications in UVR-induced pathology that includes carcinogenesis and skin aging.

Figure 1

Scheme of cutaneous melatonin synthesis and metabolism. Mass spectra of melatonin metabolites are from separated fraction with retention times of the corresponding standards [31].

Figure 2

Analysis of TPH2 expression in human skin cells. (A) RT-PCR detection of TPH2 transcripts in human tissues and cell lines. 1—Brain, 2—skin, 3—immortalized (HaCaT) epidermal keratinocytes, 4—human dermal fibroblasts, 5—immortalized human melanocytes (PIG1 line), 6—primary human melanocytes (passage 4), 7—human adult ARPE19 retinal pigment epithelium cells line (passage 26), 8—control (no cDNA template), WM—molecular weight marker (100 bp DNA Ladder (O’Range Ruler, Fermentas)). Total RNA was isolated from skin biopsy or cell lines using a total RNA extraction kit, supplemented with RNAse-free DNAse Set (both Qiagen). Two micrograms of total RNA were used for reverse transcription with SuperScript First-Strand Synthesis System (Applied Biosystems, Foster City, CA, USA). Brain cDNA was purchased from Origene. Amplification of THP2 fragments was performed using specific set of primers MZ138 (GGCTCTTTCAGGAAAAACGTG) and MZ139 (GACCACCCAGGATTTAAGGAC) synthesized by Integrated DNA Technology Inc. (Coralville, IA, USA). The PCR products were separated by agarose gel electrophoresis and stained with ethidium bromide staining. Arrow shows the expected full length (300 bp) TPH2 fragment; (B) Nucleotide (small letters) and predicted amino acid (capital letters) sequences of the amplified full length TPH2 (300 bp) fragment. Sequences of primers MZ138 (GGCTCTTTCAGGAAAAACGTG) and MZ139 (GACCACCCAGGATTTAAGGAC) used for PCR amplifications are underlined (please note that for MZ139 reverse complementary sequence is shown). Exons (2, 3, 4 and 5) positions are indicated above nucleotide sequence and exons 3 and 5 are shown in bold. Spliced out mRNA fragment (italic) and corresponding protein sequence are labeled with arrows; (C) Nucleotide and predicted amino acid sequences of the short TPH2 (255 bp) transcript. This fragment was found only in immortalized (PIG1) human melanocytes. Fragment of exon 3 is shown in bold font, exon 4 is shown in normal font. Stop codon (underlined) introduced as a result of alternative splicing is labeled with an arrow. Alternative start of translation (codon MET) is shown in bold.

Figure 3

Effect of melatonin, 6-hydroxymelatonin, N-acetylserotonin and AFMK on t-BuOOH-induced swelling of rat liver mitochondria. Swelling was measured spectrophotometrically by monitoring the absorbance at 540 nm of suspensions of mitochondria, intact or treated with 500 µM tert-butyl hydroperoxide (t-BuOOH), with or without cyclosporin A (CsA) (5 μM), and in the presence or absence of effectors (0.1, 1, 10, 100, 250 µM). Mitochondria were isolated and treated as described previously [83,115]. Protective effect of melatonin, 6-hydroxymelatonin, N-acetylserotonin and AFMK (mitochondria treated by t-BuOOH in the presence of effectors) compared to corresponding samples without effectors was considered statistically significant and indicated as * p < 0.05; ** p < 0.01; *** p < 0.001 using the Student’s t-test. Data represent mean values obtained from 3 experiments.

Figure 4

Presentation of UVR-induced release of LDH in human keratinocytes in dose- and time-dependent manner. Investigation was conducted using immortalized (HaCaT) (A) and normal (NHEK) (B) keratinocytes first pre-incubated with melatonin for 1 h (10⁻³ M) and irradiated with the UVB dose of 50 mJ/cm². Data were presented as the mean ± SEM of three independent experiments. Values were normalized and expressed as percentage of the control value, i.e., sham-irradiated sample (0 h 0 mJ/cm²) without melatonin (Mel). Statistically significant differences in melatonin versus non-melatonin treated samples at corresponding UVR doses and time points post-UVR were indicated as ** p < 0.01; *** p < 0.001; n.s., not significant, using the ANOVA with appropriate post-hoc testing (modified after Kleszczyński et al. [142] with permission from the publisher).

Figure 5

Protective effect of melatonin against UV-induced alterations within plasma membrane in human keratinocytes. (A) Fluorescent images of normal human keratinocytes (NHEK) (magnification, 40×) presenting the impact of UVR and melatonin. A representative experiment is shown. Bars = 20 μm; (B) Plasma membrane potential histograms obtained by flow cytometry after 24 h post-UVR (50 mJ/cm²) in HaCaT and NHEK keratinocytes. The horizontal axis indicates DiOC₅(3) fluorescence intensity and the vertical axis indicates number of cells. The histograms shifted to the right upon UVR exposure (hyperpolarization of mbΔψ) while presence of melatonin reversed this effect (modified after Kleszczyński et al. [142] with permission from the publisher).

Figure 6

UVR-induced changes in mitochondrial transmembrane potential and protective action of melatonin (A) in HaCaT keratinocytes. Cells were pre-incubated with melatonin (10⁻⁴ M) and irradiated with the dose of 50 mJ/cm². Mitochondrial membrane potential is indicated by JC-1 red fluorescence (left panels). Relative changes in mitochondrial membrane potential are expressed as shifts from red to green fluorescence (middle panels) and presented as the red to green ratio that produces blue fluorescence (right panel); (B) Subsequent analysis of activation of mitochondrial-dependent (intrinsic) activation of cascade of caspases 3 and 9 showed prominent cleavage of both proteins leading to increased number of apoptotic TUNEL positive cells (green) indicating on UVR-mediated DNA damage (C) Bars = 20 μm (magnification, 40×). Melatonin effectively protected the cells against these disturbances (modified after Fischer et al. [121] with permission from the publisher).

Figure 7

Melatonin (M), 6-hydroxymelatonin (6(OH)M) and AFMK (A) treated keratinocytes decrease CPD formation (A) or increase of p53 phosphorylated at Serine 15 (B) after UVB exposure. HEKn keratinocytes were treated with melatonin or its derivatives for 24 h before UVB exposure. Cells were exposed to UVB intensities of 25 mJ/cm² and immediately treated again with melatonin or its derivatives for 3 h (A) or 12 h (B). Cells were fixed and stained with anti-CPD (A) or anti-phosphorylated p53S15 (B) antibodies (green) as described in [141].

Figure 8

Protective effect of melatonin against UVR-mediated decrease of anti-oxidative enzymes in human skin in dose-dependent manner. UVR-induced decrease of CAT (A) or Cu/Zn-SOD (B) in situ protein expression was noticed directly post-UVR at the dose of 300 mJ/cm² and melatonin induced enhanced antioxidant enzyme expression. Enzymes were detected using antibodies conjugated with rhodamine (red), DAPI was used for the nucleus (blue). One representative experiment of three is shown. Dashed line shows the basement membrane. Arrows show CAT and Cu/Zn-SOD positive cells. Bars = 50 μm (magnification, 500×). Evaluated data, (C,D), were presented as pooled means ± SEM of three independent experiments containing six images taken per condition. Values were expressed as percentage of the control value, i.e., sham-irradiated without melatonin at 0 h post-UVR. Statistically significant differences were indicated as * p < 0.05; *** p < 0.001; n.s., not significant, using the ANOVA with appropriate post hoc testing (modified after Fischer et al. [144] with permission from the publisher).

Figure 9

Melatonin significantly decreases the dynamics of formation of UVR-induced oxidative DNA damage, namely 8-hydroxy-2'-deoxyguanosine in human skin. Sections were labeled using immunohistochemical staining (A) for 8-OHdG and were detected by catalyzed signal amplification using 3,3'-diaminobenzidine (yields brown-colored precipitate). One representative experiment of three is shown. Dashed line shows the basement membrane. Bars = 50 μm (magnification, 200×); Evaluated data (B) were presented as pooled means ± SEM of three independent experiments containing six taken images per condition. Statistically significant differences were indicated as ** p < 0.01; *** p < 0.001; n.s., not significant, using the ANOVA with appropriate post hoc testing, (modified after Fischer et al. [144] with permission from the publisher).