Single amino acid substitution in homogentisate 1,2-dioxygenase is responsible for pigmentation in a subset of Burkholderia cepacia complex isolates

Abstract

The Burkholderia cepacia complex (Bcc) is a group of Gram-negative bacilli that are ubiquitous in the environment and have emerged over the past 30 years as opportunistic pathogens in immunocompromised populations, specifically individuals with cystic fibrosis (CF) and chronic granulomatous disease. This complex of at least 18 distinct species is phenotypically and genetically diverse. One phenotype observed in a subset of Burkholderia cenocepacia (a prominent Bcc pathogen) isolates is the ability to produce a melanin-like pigment. Melanins have antioxidant properties and have been shown to act as virulence factors allowing pathogens to resist killing by the host immune system. The melanin-like pigment expressed by B. cenocepacia is produced through tyrosine catabolism, specifically through the autoxidation and polymerization of homogentisate. Burkholderia cenocepacia J2315 is a CF clinical isolate that displays a pigmented phenotype when grown under normal laboratory conditions. We examined the amino acid sequences of critical enzymes in the melanin synthesis pathway in pigmented and non-pigmented Bcc isolates, and found that an amino acid substitution of glycine for arginine at amino acid 378 in homogentisate 1,2-dioxygenase correlated with pigment production; we identify this as one mechanism for expression of pigment in Bcc isolates.

Fig. 1. The pigment produced by B. cenocepacia J2315 is a pyomelanin and is synthesized through tyrosine catabolism

A. Genes homologous to enzymes involved in the pyomelanin synthesis pathway were identified in the B. cenocepacia J2315 genome using sequence homology and KEGG pathway annotations. 4-HPP, 4-hydroxyphenylpyruvate; HGA, homogentisic acid. B. Growth of B. cenocepacia J2315 in LB with 1 mg ml⁻¹ tyrosine resulted in increased pigment production in comparison to growth in LB without tyrosine as determined by the OD₄₈₀ of the culture supernatant at 24 h. C. An unmarked deletion mutant in the gene that encodes the last enzyme in the pathway to make the pigment, hppD (BCAL0207), was constructed in B. cenocepacia J2315 and this strain was non-pigmented. The system for making unmarked deletions through gene splicing by overlap extension described by Flannagan and colleagues (2008) was used to create B. cenocepacia J2315 ΔhppD. The deletion construct was made by amplifying the flanking regions of the gene using the following four primers: F1-XbaI (GGTCTAGAAATCGGCAACGCCGTCGTTTCCTTGAAGC), R1 (TGCCGCGCGGTGCAAGCGGTCGTGTCTCCTGTGCGG), F2 (CCGCACAGGAGACACGACCGCTTGCACCGCGCGGCA) and R2 EcoRV (GGGATATCTTCGCCGGTTTTACGGGATGGTAGCACTGG).

Fig. 2. A glycine at residue 378 of HmgA is conserved among Bcc strains and is changed to an arginine in B. cenocepacia J2315

A. Diagram of the HmgA gene of Bcc showing iron-binding sites. The region marked in brackets corresponds to residues 363–400, which are aligned below. B. Sequences of inferred amino acid sequence of the hmgA gene from Bcc strains from residues 364–400 were aligned to show conservation of a glycine at residue 378. Sequence identity of the entire proteins ranged between 94% and 99%.

Fig. 3. Expression of hmgA from a non-pigmented strain results in a non-pigmented phenotype in B. cenocepacia

A. The hmgA genes from B. cenocepacia J2315 and K56-2 were amplified from genomic DNA using hmgA Fd SacI (CTAGGAGCTCATGACGCTTGACCTGTCGAAACCGGCAA) and hmgA Rv XbaI (CTAGAGATCTTCATCGTTGCTCCGGATTGA). The PCR products were cloned into TOPO pCR2.1 (Invitrogen) and then digested with SacI and XbaI. Digested inserts were ligated into similarly digested pUCP18Tc (Schweizer, 1991) and sequenced to confirm identity. pUCP18Tc and recombinant hmgA-containing plasmids were electroporated into B. cenocepacia J2315 and K56-2 using a modified version of a protocol published previously (Dubarry et al., 2010). The resultant plasmid-containing strains were grown in LB with 100 μg ml⁻¹ tetracycline at 37°C with shaking for 24–30 h and then evaluated the level of pigmentation by assaying the OD₄₈₀ of the supernatant. B. Recombinant plasmids containing the hmgA genes from J2315 (pUCP18Tc-JhmgA), K56-2 (pUPC18Tc-KhmgA) or the vector (pUCP18Tc) were transferred to P. aeruginosa PA14 hmgA::Tn. For images of pigmented phenotypes, overnight cultures of bacteria were diluted and spotted onto agar plates, which were incubated at 37°C and visualized after 24–48 hours. Liquid cultures were incubated at 37°C in LB with 50 μg ml⁻¹ tetracycline for plasmid-containing strains, and without for non-plasmid containing strains with shaking for 30–35 h and then evaluated for the level of pigmentation by assaying the OD₄₈₀ of the supernatant. C. Susceptibility to H₂O₂ of J2315 strains expressing pUCP18Tc, pUCP18Tc-KhmgA, pUCP18Tc-JhmgA was measured after exponential phase cultures were incubated for 45 min with 5 mM H₂O₂ and then grown out for 48 h on LB. Susceptibility was measured by calculating colony-forming units (cfu) after culture sample was incubated with 5 mM H₂O₂ divided by cfu of culture sample incubated in LB. D. Susceptibility to H₂O₂ of PA14 WT or PA14 hmgA::Tn was measured after exponential phase cultures were incubated for 45 min with 25 mM H₂O₂ and then grown out for 24 h on LB. Susceptibility was measured by calculating cfu after culture sample was incubated with 25 mM H₂O₂ divided by cfu of culture sample incubated in LB.