Suppression of subtelomeric VSG switching by Trypanosoma brucei TRF requires its TTAGGG repeat-binding activity

Abstract

Trypanosoma brucei causes human African trypanosomiasis and regularly switches its major surface antigen, VSG, in the bloodstream of its mammalian host to evade the host immune response. VSGs are expressed exclusively from subtelomeric loci, and we have previously shown that telomere proteins TbTIF2 and TbRAP1 play important roles in VSG switching and VSG silencing regulation, respectively. We now discover that the telomere duplex DNA-binding factor, TbTRF, also plays a critical role in VSG switching regulation, as a transient depletion of TbTRF leads to significantly more VSG switching events. We solved the NMR structure of the DNA-binding Myb domain of TbTRF, which folds into a canonical helix-loop-helix structure that is conserved to the Myb domains of mammalian TRF proteins. The TbTRF Myb domain tolerates well the bulky J base in T. brucei telomere DNA, and the DNA-binding affinity of TbTRF is not affected by the presence of J both in vitro and in vivo. In addition, we find that point mutations in TbTRF Myb that significantly reduced its in vivo telomere DNA-binding affinity also led to significantly increased VSG switching frequencies, indicating that the telomere DNA-binding activity is critical for TbTRF's role in VSG switching regulation.

Figure 1.

A transient depletion of TbTRF led to an elevated VSG switching frequency. (A) S/TRFi cells experienced a transient growth arrest upon induction of TbTRF RNAi by 100 μg/ml doxycycline for 24 h. Growth curves were calculated from three independent experiments. A7, A8 and B1 are independent S/TRFi clones. In this and other figures, error bars represent standard deviation. (B) TbTRF protein level decreased upon induction of TbTRF RNAi for 24 h. Western blotting was performed using whole cell lysate prepared from S/TRFi clone B1 cells and TbTRF (21) and EF-2 (Santa Cruz Biotechnology, Inc.) antibodies. (C) VSG switching frequencies in S/v, S/TRFi B1 and S/TRFi+F2H-TbTRF cells with or without a transient TbTRF RNAi induction. Average switching frequencies were calculated from at least three independent switching assays. Numbers on columns indicate P values (unpaired t tests) when compared to the switching frequency in S/v cells. A P value less than 0.05 is considered significantly different. (D) VSG switching mechanism distribution in S/TRFi B1 cells under the induced and uninduced conditions. The total number of switchers characterized is indicated above each column. GC, gene conversion; CO, crossover.

Figure 2.

Structure of TbTRF Myb domain. (A) The ¹H-¹⁵N HSQC spectrum of ¹⁵N-labeled TbTRF Myb domain at pH 5.8. A selected region of the spectrum enclosed by a framed rectangle is expanded to show the detail of residue assignments. (B) Ensemble of the final 20 lowest energy structures of TbTRF overlaid on the backbone. The three helices H1–H3 are drawn as ribbons. (C) Structural alignment of TbTRF Myb domain (light blue) with that of human TRF1 (light yellow, PDB ID 1ITY) and TRF2 (gold, PDB ID 1VF9). The TbTRF Myb domain is the energy minimized average structure generated from the ensemble. (D) The hydrophobic core and the D306-H346 salt bridge in the TbTRF Myb structure.

Figure 3.

Characterization of TbTRF binding to telomeric DNA. (A) ITC-based measurement of TbTRF Myb–DNA interaction using regular (left) and J-containing oligo (right). Each measurement was repeated three times. Values of binding affinity (K_d), stoichiometry (N) and binding enthalpy (ΔH) with standard deviation are shown. (B) J does not influence the binding of TbTRF on telomeric DNA in vivo. ChIP was performed using TbTRF antibody (21) in cells grown in normal medium, medium with Dimethyl sulfoxide (DMSO) or medium with 0.5 mM Dimethyloxalylglycine (DMOG) dissolved in DMSO. Southern analyses using the TTAGGG repeat (left) or the 50 bp repeat (right) probe were performed to hybridize the ChIP products. Southern blots were exposed to phosphorimager screens and the percentage of enrichment was calculated by dividing the ChIP signal by the input signal. Average values were calculated from at least three independent experiments.

Figure 4.

Key DNA-binding residues within TbTRF Myb domain. (A) Superposition plot of the ¹H–¹⁵N HSQC spectra of TbTRF alone and TbTRF titrated with a double-repeat DNA oligo pair in 1:0.5 molar ratio. (B) Model of TbTRF Myb domain bound to telomeric DNA generated by superimposing TbTRF Myb onto human TRF1 Myb–DNA complex structure (PDB ID 1IV6). (C) Model of TbTRF Myb bound to a J-containing DNA. The J-DNA (PDB ID 308D) is superimposed onto regular DNA in the TbTRF Myb–DNA complex structure of (B). (D) Binding affinity (K_d) of WT and mutant TbTRF Myb domain with a duplex telomeric oligo of sequence 5′ GGCGCGCTTAGGGTTAGGGTTACCGCCCG 3′ as measured by ITC. (E) ChIP analyses of TbTRF myb point mutants. ChIP experiments were performed using TbTRF antibody (21) or normal rabbit immunoglobulin G in cells expressing the TbTRF Myb point mutant as the only TbTRF allele. Southern hybridizations were performed using the TTAGGG repeat probe or the 50 bp repeat probe as a control (Supplementary Figure S5C). Southern blots were exposed to a phosphorimager screen and signal intensities were quantified. The percentage of enrichment was calculated by dividing the ChIP signal by the input signal. The average was calculated from at least three independent experiments. P values (unpaired t tests) of TbTRF ChIP result between each mutant and TbTRF +/- are listed on each column.

Figure 5.

TbTRF myb mutations that decreased the telomere DNA-binding activity also increased the VSG switching frequencies. (A) VSG switching frequencies in S/TRF sko and S/TRF mutants. Average values were calculated from at least three independent experiments. P values (unpaired t tests) comparing S/TRF sko and S/TRF mutants are indicated on each column. (B) VSG switching mechanism distribution in S/TRF sko and S/TRF mutants. The total number of switchers characterized is indicated above each column.