The impact of anti-inflammatory cytokines on the pancreatic β-cell

Abstract

Considerable efforts have been invested to understand the mechanisms by which pro-inflammatory cytokines mediate the demise of β-cells in type 1 diabetes but much less attention has been paid to the role of anti-inflammatory cytokines as potential cytoprotective agents in these cells. Despite this, there is increasing evidence that anti-inflammatory molecules such as interleukin (IL)-4, IL-10 and IL-13 can exert a direct influence of β-cell function and viability and that the circulating levels of these cytokines may be reduced in type 1 diabetes. Thus, it seems possible that targeting of anti-inflammatory pathways might offer therapeutic potential in this disease. In the present review, we consider the evidence implicating IL-4, IL-10 and IL-13 as cytoprotective agents in the β-cell and discuss the receptor components and downstream signaling pathways that mediate these effects.

Keywords: GSIS, glucose-stimulated insulin secretion; IL, interleukin; Jak, janus kinase; NO, nitric oxide; PTP, protein tyrosine phosphatase; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; STAT3; STAT6; T1D, type 1 diabetes; Th, T-helper; interleukin-10; interleukin-13; interleukin-4; type 1 diabetes.

Figure 1.

Canonical signal transduction via IL-4, IL-13 and IL-10 receptors. IL-4 interacts with either the IL-4Rα/common γ-chain or the IL-4Rα/IL-13α1 receptor complexes, whereas IL-13 binds to an IL-4Rα/IL-13α1 dimer or to an IL-13α2 monomer. IL-10 signals via IL-10Rα/IL-10Rβ. IL-4 and IL-13 are known to preferentially induce STAT6 signaling while IL-10 responses are usually mediated via STAT3.

Figure 2.

IL-10 receptor components are expressed in pancreatic endocrine cells. The expression of IL-10Rα and IL-10Rβ was examined by RT-PCR in cDNA generated from human islets and INS-1E cells. Amplified products were separated on agarose gels and examined under UV illumination after staining with Gel Red. Arrows indicate the position of the 300bp marker. To confirm their identity, bands were extracted and sequenced. Primer pairs used for PCR analysis were: IL-10Rα (human) Fd: ATGACCTTACCGCAGTGACC Rv: TCCAGAGGTTAGGAGGCTGA, IL-10Rβ (human) Fd: CTCGGCTGCTTCGCCTTGCT Rv: CTAGCTTTGGGGCCCCTGCC, IL-10Rα (rat) Fd: CCTGCATGGCAGCACCGACA Rv: ACAACCATGGCCCAAGGCGG, IL-10Rβ (rat) Fd: CCCTCCCTGGATCGTGGCCA Rv: AGCTCCTGAGGCCCTGCCTC.

Figure 3.

Possible pathways of IL-4 and IL-13 signaling in pancreatic β-cells. Following interaction of IL-4 with its cognate receptors, Jak kinases are phosphorylated. This leads to the recruitment and activation of STAT6 and to activation of the PtdIns-3K/Akt pathway. IL-13 also activates both the STAT6 and PI-3K/Akt pathways but there is evidence that STAT3 may also become phosphorylated. IL-4 and IL-13 induced cytoprotection is probably mediated via STAT6 and the extent of phosphorylation of this molecule is also regulated by PTP-BL. The functional consequences of IL-13-induced STAT3 phosphorylation are unclear. In addition, the increase in Akt phosphorylation mediated by IL-13 is not obligatory for cytoprotection.