Effect of Ca2EDTA on zinc mediated inflammation and neuronal apoptosis in hippocampus of an in vivo mouse model of hypobaric hypoxia

Abstract

Background: Calcium overload has been implicated as a critical event in glutamate excitotoxicity associated neurodegeneration. Recently, zinc accumulation and its neurotoxic role similar to calcium has been proposed. Earlier, we reported that free chelatable zinc released during hypobaric hypoxia mediates neuronal damage and memory impairment. The molecular mechanism behind hypobaric hypoxia mediated neuronal damage is obscure. The role of free zinc in such neuropathological condition has not been elucidated. In the present study, we investigated the underlying role of free chelatable zinc in hypobaric hypoxia-induced neuronal inflammation and apoptosis resulting in hippocampal damage.

Methods: Adult male Balb/c mice were exposed to hypobaric hypoxia and treated with saline or Ca2EDTA (1.25 mM/kg i.p) daily for four days. The effects of Ca2EDTA on apoptosis (caspases activity and DNA fragmentation), pro-inflammatory markers (iNOS, TNF-α and COX-2), NADPH oxidase activity, poly(ADP ribose) polymerase (PARP) activity and expressions of Bax, Bcl-2, HIF-1α, metallothionein-3, ZnT-1 and ZIP-6 were examined in the hippocampal region of brain.

Results: Hypobaric hypoxia resulted in increased expression of metallothionein-3 and zinc transporters (ZnT-1 and ZIP-6). Hypobaric hypoxia elicited an oxidative stress and inflammatory response characterized by elevated NADPH oxidase activity and up-regulation of iNOS, COX-2 and TNF-α. Furthermore, hypobaric hypoxia induced HIF-1α protein expression, PARP activation and apoptosis in the hippocampus. Administration of Ca2EDTA significantly attenuated the hypobaric hypoxia induced oxidative stress, inflammation and apoptosis in the hippocampus.

Conclusion: We propose that hypobaric hypoxia/reperfusion instigates free chelatable zinc imbalance in brain associated with neuroinflammation and neuronal apoptosis. Therefore, zinc chelating strategies which block zinc mediated neuronal damage linked with cerebral hypoxia and other neurodegenerative conditions can be designed in future.

Figure 1. Effect of Ca₂EDTA administration on the expression of genes that regulate zinc homeostasis in the hippocampus of animals after exposure to hypobaric hypoxia.

Graph represents the relative OD of ZIP-6 (335 bp) [A], ZnT-1 (249 bp) [B] and MT-3 (123 bp) [C] mRNAs expression in the hippocampus. The expression of all genes were normalized to the level of GAPDH mRNA and representative of three experiments in duplicate. ** p<0.01, # p<0.05. * compared hypoxia vs normoxia and normoxia treated with Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N-normoxia, NED-normoxia treated with Ca₂EDTA, IH-hypoxia and HED-hypoxia treated with Ca₂EDTA. Lane 1,2-normoxia, Lane 3,4-normoxia treated with Ca₂EDTA, Lane 5,6- hypoxia and Lane 7,8- hypoxia treated with Ca₂EDTA. M indicate marker lane (A, B and C). ZIP-6: Forward-5′-AGCAGCCGACGATGTTGGAAGA-3′, Reverse: 5′- TGAAGGCAGCACCAATAGCAAG-3′ (335 bp); ZnT-1: Forward: 5′-TCGTGAATGCCTTGGTCTTTTA-3′, Reverse: 5′-GTTTGTAGAAGAATGAGAGCAGACT-3′ (249 bp); MT-3: Forward: 5′-CTGTCCTACTGGTGGTTCCTGC-3′, Reverse: 5′- GTCCTTGGCACACTTCTCACATC-3′ (123 bp).

Figure 2

A. Photomicrograph shows the expression of MT-3 counter stained with Hoechst 33342 in CA3 hippocampal region of Normoxia (a), Normoxia treated with Ca₂EDTA (b), Hypoxia (c), Hypoxia treated with Ca₂EDTA (d) (Magnification ×400). B. Graph represents relative mean fluorescence intensity of MT-3 expression in hippocampal sections of CA3 region.C. Western blot analysis and quantification of MT-3 ***, ### indicate p<0.001. * compared hypoxia with normoxia treated with Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. NED-normoxia treated with Ca₂EDTA, IH-hypoxia and HED-hypoxia treated with Ca₂EDTA. Scale bar  = 5 µm.

Figure 3. Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in expression of HIF-1α.

Photomicrographs show the expression of HIF-1α counter stained with Hoechst 33342 (A) in CA3 hippocampal region of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c) and hypoxia treated with Ca₂EDTA (d) (Magnification ×400). Graph represents relative mean fluorescence intensity of HIF-1α expression in hippocampal sections of CA3 region (B) and HIF-1α mRNA (216 bp) expression and relative OD (C) in hippocampus. *** indicate p<0.001;* compared hypoxia vs normoxia treated with Ca₂EDTA. ## indicate p<0.01, # compared hypoxia hreated Ca₂EDTA vs hypoxia. NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Lane 1,2-Normoxia, Lane 3,4-Normoxia treated with Ca₂EDTA, Lane 5,6- Hypoxia and Lane 7,8- Hypoxia treated with Ca₂EDTA. M indicate Marker lane. HIF-1α – Forward primer: 5′ - AGAAACCTACCATCACTGCCACT- 3′, Reverse primer: 5′ – TGTTCTATGACTCTCTTTCCTGC - 3′ (216 bp). Scale bar  = 5 µm.

Figure 4. Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in the expression of inflammatory mediators.

Graphs represent the relative OD of TNF-α mRNA (A); iNOS mRNA (B) and iNOS protein (C) expression in the hippocampus. ***, ### indicate p<0.001. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N- Normoxia, NED-Normoxia treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia treated with Ca₂EDTA. Lane 1,2-Normoxia, Lane 3,4-Normoxia treated with Ca₂EDTA, Lane 5,6- Hypoxia and Lane 7,8- Hypoxia treated with Ca₂EDTA. M indicate Marker lane. TNF-α: Forward Primer: 5′- CTGAGTTGGTCCCCCTTCT - 3′, Reverse primer: 5′ – CCGATGGGTTGTACCTTGT -3′ (240 bp); iNOS: Forward primer: 5′-ATGGACCAGTATAAGGCAAG-3′, Reverse primer: 5′-CTCTGGATGAGCCTATATTG-3′ (427 bp).

Figure 5. Effect of Ca₂EDTA on hypobaric hypoxia induced alteration in the expression of inflammatory mediators.

Photomicrographs show the expression of iNOS (A), COX-2 (C) and TNF-α (E), counter stained with Hoechst 33342 on CA3 hippocampal regions of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c), hypoxia treated with Ca₂EDTA (d) (Magnification ×400). Graph represents relative mean fluorescence intensity of iNOS (B), COX-2 (D) and TNF-α (F) expression in hippocampal sections of CA3 region. *** indicate p<0.001, **, ## indicate p<0.01, # indicate p<0.05. * compared hypoxia vs normoxia treated Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. NED-normoxia treated with Ca₂EDTA, IH-hypoxia and HED-hypoxia treated with Ca₂EDTA. Scale bar  = 5 µm.

Figure 6. Effect of Ca₂EDTA on nitrite content, NADPH oxidase activity, LPO level, and PARPactivity.

Graph represents the total nitrite level (A), NADPH Oxidase activity (B), lipid peroxidation (C) and PARP activity assay (D) in the hippocampal tissue homogenate. ***, ### indicate p<0.001, **, ## indicate p<0.01. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA, # compared hypoxia treated Ca₂EDTA vs hypoxia. N-Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA.

Figure 7. Effect of free chelatable zinc on hypobaric hypoxia induced alteration in Bax/Bcl-2 expression.

Graph represents the relative mRNA expression of Bax/Bcl-2 in the hippocampus (A). Lane 1-Normoxia, Lane 2-Normoxia treated with Ca₂EDTA, Lane 3- Hypoxia and Lane 4- Hypoxia treated with Ca₂EDTA. Graph (B) represents the relative protein expression of Bax/Bcl-2 in the hippocampus. Lane 1-Normoxia, Lane 2-Normoxia treated with Ca₂EDTA, Lane 3- Hypoxia and Lane 4- Hypoxia treated with Ca₂EDTA. *, # indicate p<0.05. ***, ### indicate p<0.001. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N- Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Bcl-2: Forward -5′-CTGGCATCTTCTCCTTCCAG-3′; Reverse - 5′-GACGGTAGCGACGAGAGAAG-3′ (183 bp); Bax: Forward: 5′-TGAAGACAGGGGCCTTTTTG-3′; Reverse: 5′-AATTCGCCGGAGACACTCG-3′ (139 bp).

Figure 8. Effect of free chelatable zinc on hypobaric hypoxia induced apoptosis.

A. Photomicrographs of TUNEL stained hippocampus CA3 region (A) of normoxia (a), normoxia treated with Ca₂EDTA (b), hypoxia (c), and hypoxia treated with Ca₂EDTA (d) (Magnification 400X). Arrow head shows TUNEL positive neurons. Graph (B) represents the number of TUNEL positive neurons from the sections of hippocampus CA3 region, caspase 9 (C), caspase 8 (D) and caspase 3 (E) activities. *** indicate p<0.01, **, ## indicate p<0.01. * compared hypoxia vs normoxia and normoxia treated Ca₂EDTA and hypoxia treated with Ca₂EDTA. # compared hypoxia treated Ca₂EDTA vs hypoxia. N- Normoxia, NED-Normoxia Treated with Ca₂EDTA, IH-Hypoxia and HED-Hypoxia Treated with Ca₂EDTA. Scale bar  = 5 µm.

Figure 9. Schematic illustration of the role of free chelatable zinc during hypoxic conditions.

Zinc chelator alters the accumulation of free zinc in the hippocampus thus, reduces oxidative stress and inhibits PARP activation. Oxidative stress and PARP collectively modulate Bcl-2 expression resulting in Bax mediated activation of caspases leading to apoptotic neurodegeneration during hypoxic stress which is reduced significantly by the treatment zinc chelator.