Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2015 Jan 13;84(2):206-8.
doi: 10.1212/WNL.0000000000001130. Epub 2014 Dec 3.

Homozygosity of the autosomal dominant Alzheimer disease presenilin 1 E280A mutation

Kenneth S Kosik  1 , Claudia Muñoz  2 , Liliana Lopez  2 , Mary Luz Arcila  2 , Gloria García  2 , Lucía Madrigal  2 , Sonia Moreno  2 , Silvia Ríos Romenets  2 , Hugo Lopez  2 , Madelyn Gutierrez  2 , Jessica B Langbaum  2 , William Cho  2 , Shehnaaz Suliman  2 , Pierre N Tariot  2 , Carole Ho  2 , Eric M Reiman  2 , Francisco Lopera  2
Affiliations

Homozygosity of the autosomal dominant Alzheimer disease presenilin 1 E280A mutation

Kenneth S Kosik et al. Neurology. .
No abstract available

PubMed Disclaimer

Figures

Figure
Figure. Genotype analysis
(A) PSEN1 was amplified using the following primers—forward AACAGCTCAGGAGAGGAATG3, reverse TGAACAGAGTAG—around the mutation site. We used 40 ng of PCR product for restriction digestion with 0.5 units of Mva1269I (Fermentas, Vilnius, Lithuania) for 16 hours at 37°C, and cleaned digestion products using the Qiagen clean up reaction kit. We ran the products on a Bioanalyzer DNA chip (Agilent, Santa Clara, CA). (B) In one patient, we confirmed the mutation by sequencing 20 ng of PCR product (sent to UCLA genotyping and sequencing core). The reported sequences were analyzed using Sequence scanner v1.0 (Applied Biosystems, Foster City, CA).
See this image and copyright information in PMC

References

    1. Lopera F, Ardilla A, Martínez A, et al. Clinical features of early-onset Alzheimer disease in a large kindred with an E280A presenilin-1 mutation. JAMA 1997;277:793–799. - PubMed
    1. Lalli MA, Cox HC, Arcila ML, et al. Origin of the PSEN1 E280A mutation causing early-onset Alzheimer's disease. Alzheimers Dement 2014;10(5 suppl):S277–S283. - PMC - PubMed
    1. Reiman EM, Langbaum JB, Fleisher AS, et al. Alzheimer's prevention initiative: a plan to accelerate the evaluation of presymptomatic treatments. J Alzheimers Dis 2011;26(suppl 3):321–329. - PMC - PubMed
    1. Zlotogora J. Dominance and homozygosity. Am J Med Genet 1997;68:412–416. - PubMed
    1. Ayutyanont N, Langbaum JB, Hendrix SB, et al. The Alzheimer's prevention initiative composite cognitive test score: sample size estimates for the evaluation of preclinical Alzheimer's disease treatments in presenilin 1 E280A mutation carriers. J Clin Psychiatry 2014;75:652–660. - PMC - PubMed

Supplementary concepts