Genetic polymorphisms of heme-oxygenase 1 (HO-1) may impact on acute kidney injury, bronchopulmonary dysplasia, and mortality in premature infants

Abstract

Background: Heme oxygenase 1 (HO1) catalyzes heme degradation, and offers protection for several organs, including the kidney. Genetic polymorphisms of HO-1 are associated with poor clinical outcomes in several populations.

Population: We prospectively enrolled 117 premature infants (birth weight ≤1,200 g or postgestational age ≤31 wk) and evaluated two DNA genetic variants proximal to the promoter region of HO-1 (GT(n) repeats, and -413T>A SNP). We evaluated how these polymorphisms affect two clinical outcomes: (i) Acute Kidney Injury (AKI)-rise in serum creatinine (SCr) ≥ 0.3 mg/dl or ≥ 150-200% from lowest previous value, (ii) the composite of mortality and bronchopulmonary dysplasia (BPD) defined as receipt of oxygen at 36 wk postmenstrual age.

Results: AKI occurred in 34/117 (29%) of neonates; 12/117 (10%) died; 29/105 (28%) survivors had BPD. Neonates with TT genotype at 413T>A before the HO-1 promoter had higher rates of AKI (P < 0.05). There was no difference in number of GT(n) repeats and clinical outcomes.

Conclusion: We did not find an association between the GT(n) tandem repeat of HO-1 and AKI nor BPD/mortality. However, infants with TT genotype of the 413T>A genetic alteration had lower incidence of AKI. Further studies using larger cohorts are needed to better understand these relationships.

Figure 1

Enrollment and reasons for non-participation in those who met inclusion and exclusion criteria for the study. Birth weight, Apgar scores, and gestational age were not different between consented and non-consented groups.

Figure 2

Primers for promoter of HO1 Homo sapiens heme oxygenase (decycling) 1 (HMOX1), RefSeqGene on chromosome 22 NCBI Reference Sequence: NG_023030.1 (primers are shown in italics; GT(n) repeats are shown with bold; −413 location is shown in bold).

Figure 3

The −413 T>A SNP was documented for each allele using aqMan Assay (rs2071746) AGTTCCTGATGTTGCCCACCAGGCT[A/T]TTGCTCTGAGCAGCGCTGCCTCCCA) □ = AA Alleles, △ = AT Alleles, ○ = TT Alleles; RFU=relative fluorescent units.