Latent herpes simplex virus 1 infection does not induce apoptosis in human trigeminal Ganglia

Abstract

Herpes simplex virus 1 (HSV-1) can establish lifelong latency in human trigeminal ganglia. Latently infected ganglia contain CD8(+) T cells, which secrete granzyme B and are thus capable of inducing neuronal apoptosis. Using immunohistochemistry and single-cell reverse transcription-quantitative PCR (RT-qPCR), higher frequency and transcript levels of caspase-3 were found in HSV-1-negative compared to HSV-1-positive ganglia and neurons, respectively. No terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) assay-positive neurons were detected. The infiltrating T cells do not induce apoptosis in latently infected neurons.

FIG 1

(A and D) Micrograph of human TG stained for LAT by ISH. The circle indicates a LAT⁺ neuron. (B) Micrograph of staining for TUNEL. The circle indicates the same neuron as in panel A on a consecutive slide that is TUNEL negative. (C) Micrograph of the positive control for detection of DNA fragmentation (DNase I treatment). The circle indicates a TUNEL-positive neuron. (E) Micrograph of staining for active caspase-3. The circle indicates the same neuron as in panel D on a consecutive slide that is active caspase-3 negative. (F) Micrograph of active caspase-3-positive neuron. The circle indicates an active caspase-3-positive neuron. All tissues were counterstained with hematoxylin, except for panel F; this tissue was counterstained with methyl green. Scale bars represent 50 μm.

FIG 2

Box plot A shows the difference in the expression of caspase-3 in LAT⁺ and LAT⁻ single neurons. Box plot B shows the difference in the expression of caspase-3 in LAT⁺ and LAT⁻ whole ganglia. Boxes denote interquartile ranges, lines denote medians, and whiskers denote the 5th and 95th percentiles. Each measurement was done in duplicate. The results were normalized to the housekeeping gene coding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For the commercially available TaqMan gene expression assays, the caspase-3 assay identification (ID) number is Hs00234387_m1 and the GAPDH assay ID number is Hs02758991_g1. For the custom-made TaqMan gene expression assay, the sequences of the LAT primers were CCCACGTACTCCAAGAAGGC (forward) and AGACCCAAGCATAGAGAGCCAG (reverse), and the probe sequence was CCCACCCCGCCTGTGTTTTTGTGT (Life Technologies, Darmstadt, Germany).

FIG 3

Fluorescence labeling of human TG stained for CD8⁺ T cells (red) and GrB (green) and with nucleus stained with DAPI (4′,6-diamidino-2-phenylindole) (blue). Stained sections were analyzed by confocal imaging. The micrograph on the left was taken at a ×100 magnification for an overview, and the one on the right is shown at 400× for a more detailed view. Dashed circles indicate neurons with lipofuscin in red, and arrows indicate GrB-positive CD8⁺ T cells. Scale bars represent 50 μm.