A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

Abstract

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

FIG 1

Genetic organization of 12 known dpt genes and the genes adjacent to them, from dptR3 to orf53, in S. roseosporus WT strain NRRL11379 (A) and a schematic strategy for deletion of dptR3 (B). (A) Long black lines, transcriptional units. Short lines at the bottom, probes of the promoter regions used for EMSAs. (B) Large arrows, genes and their directions. Short arrows, positions of primers used for cloning exchange regions and confirming gene deletion as described in Materials and Methods. Rectangles, homologous exchange regions used for deletion of dptR3.

FIG 2

Daptomycin production and growth of S. roseosporus WT and dptR3 mutant strains. (A) Effect of dptR3 deletion on morphological development. The WT strain, the dptR3 deletion mutant (DR3), and the complemented strain (CR3) were grown on MM agar, R2YE, and DA1 plates at 28°C, and the plates were photographed every 48 h. (B) Daptomycin yields of the WT (⧫), DR3 (■), and CR3 (▲). (C) Growth curves of the WT, DR3, and CR3. Cell growth was measured in cell dry weight. (D) Comparison of daptomycin production in the WT, vector control strain WT/pKC1139, and dptR3 overexpression strains WT/pKC1139-ermpR3-1 and -2 grown in fermentation medium for 10 days. S. roseosporus was cultivated in 250-ml shaking flasks containing 50 ml of seed medium or fermentation medium. Apramycin was added to primary and secondary seed medium of WT/pKC1139 and WT/pKC1139-ermpR3 for plasmid selection. Error bars show the standard deviation of three replicate flasks. Statistical significance was determined by comparing the mutant values to those of the WT strain. **, P < 0.01; NS, not significant.

FIG 3

Real-time RT-PCR analysis of the dpt and orf16 gene transcription levels in the WT and DR3 strains. RNA samples were isolated from 2- and 4-day fermentation cultures. The relative transcription levels of each gene were obtained after normalization against the internal reference hrdB at corresponding time points. dptR3, 60-bp transcript amplified from the remainder ORF of dptR3 in DR3 with primers ZQL75 and ZQL76. Error bars show the standard deviation of three independent experiments. Statistical significance was determined by Student's t test. *, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, not significant.

FIG 4

EMSAs of DptR3 binding to the dptR3-orf16 intergenic region. (A) EMSAs of the interaction of promoter regions with purified His₆-DptR3 protein. Each lane contained 0.15 nM labeled probe. EMSAs with 50-fold unlabeled specific probe (S) or nonspecific (N) competitor DNA were performed to confirm the specificity of band shifts. Labeled probe hrdB was used to eliminate nonspecific binding of DptR3 protein. BSA was used as a negative control for DptR3 protein. The labeled probes were incubated in the absence (−) or presence of various amounts (50, 100, 150, 200 ng) of His₆-DptR3. Two hundred nanograms of His₆-DptR3 was used for control probe hrdB and competition experiments. (B) EMSAs of His₆-DptR3 (150 ng) interaction with daptomycin. Arrowhead, free probe; bracket, DptR3-DNA complex.

FIG 5

dptR3 and orf16 promoter structures and DptR3-binding site in the dptR3-orf16 intergenic region. (A) Determination of TSPs of dptR3 and orf16 by 5′ RACE PCR. Boxed areas, complementary sequences of 5′ RACE oligo(dT) anchor primers. Bent arrows, complementary bases of TSPs. (B) DNase I footprinting assay of DptR3 in the dptR3-orf16 intergenic region. Fluorograms correspond to control DNA (10 μM BSA) and to protection reactions with increasing concentrations of His₆-DptR3 protein. (C) Nucleotide sequences of the dptR3-orf16 promoter region and the DptR3-binding site. The numbers are distances (in nucleotides) from the TSP of dptR3. Solid line, DptR3-binding site. Straight arrows, inverted repeats. Bent arrows, TSP and transcription orientation. Boxed areas, putative −10 and −35 regions. Shaded areas, translational start codon.

FIG 6

Mutational analysis of the DptR3-binding site. (A) DNA probes containing an intact palindromic sequence in the DptR3-binding site or mutated sequences. Probes 1a and b, 50-bp WT DNA containing intact palindromic sequences a and b, respectively. Mutations were introduced into probe b to produce mutated probes bm1, bm2, and bm3, respectively. Altered nucleotides are underlined. (B) EMSAs with various DNA probes. Each probe was incubated with 50, 100, 150, and 200 ng of His₆-DptR3 (concentrations increase from left to right in each series of four lanes, as indicated by the triangles above the blots).

FIG 7

Effect of orf16 deletion on daptomycin production and cell growth. (A) Strategy used for deletion of orf16. (B) Comparison of daptomycin production in WT and orf16 deletion mutants D16-1 and -2 grown in fermentation medium for 10 days. ***, P < 0.001. (C) WT and D16-1 growth curves.