Mutational Analysis of the Antitoxin in the Lactococcal Type III Toxin-Antitoxin System AbiQ

Abstract

The lactococcal abortive phage infection mechanism AbiQ recently was classified as a type III toxin-antitoxin system in which the toxic protein (ABIQ) is regulated following cleavage of its repeated noncoding RNA antitoxin (antiQ). In this study, we investigated the role of the antitoxin in antiphage activity. The cleavage of antiQ by ABIQ was characterized using 5' rapid amplification of cDNA ends PCR and was located in an adenine-rich region of antiQ. We next generated a series of derivatives with point mutations within antiQ or with various numbers of antiQ repetitions. These modifications were analyzed for their effect on the antiphage activity (efficiency of plaquing) and on the endoribonuclease activity (Northern hybridization). We observed that increasing or reducing the number of antiQ repeats significantly decreased the antiphage activity of the system. Several point mutations had a similar effect on the antiphage activity and were associated with changes in the digestion profile of antiQ. Interestingly, a point mutation in the putative pseudoknot structure of antiQ mutants led to an increased AbiQ antiphage activity, thereby offering a novel way to increase the activity of an abortive infection mechanism.

FIG 1

AbiQ operon and PCR products of the 5′RACE assay. (A) The specific position (and orientation) of each primer (arrows) is represented in the schematic form of the operon AbiQ. The PCR products are Ctrl-PCR (AbiQFwd/AbiQRev; water as the template), Ctrl-DNA (AbiQFwd/AbiQRev; RNA without retrotranscription as the template), Ctrl+ (AbiQFwd/AbiQRev; cDNA as the template), and RACE-AbiQ (PolyC/AbiQRev; cDNA as the template). (B) 5′RACE PCR products of the AbiQ operon separated on a 2.0% agarose gel. Red arrows point out the three PCR product bands. The molecular size standard was a 1-kb Plus DNA ladder (Invitrogen).

FIG 2

Sequences of the 12 pBS-KS::RACE-AbiQ clones. The repeats (R) and the transcription start site (position −7/−6) are indicated over the first sequence (clone 1), with different shades of gray representing the three repeats. ·, identical sequence; −, the absence of the nucleotide in the sequenced clone.

FIG 3

Efficiency of plaquing (EOP), size of lysis plaques, and digestion profile of antiQ for wild-type and mutated AbiQ operons. One antiQ repeat (GCTCCAATTTTATCAATTCCAACTATGGCTTGGATA) was used as a probe to define the digestion profile for AbiQ mutants in Northern hybridization experiments. Superscript letters: a, EOP and standard deviations were calculated from at least three biological assays; b, P008 infecting L. lactis IL1403 pNZ123 (AbiQ⁻) produces lysis plaques of 3 to 5 mm.