Minireview: Activin Signaling in Gonadotropes: What Does the FOX say… to the SMAD?

Abstract

The activins were discovered and named based on their abilities to stimulate FSH secretion and FSHβ (Fshb) subunit expression by pituitary gonadotrope cells. According to subsequent in vitro observations, activins also stimulate the transcription of the GnRH receptor (Gnrhr) and the activin antagonist, follistatin (Fst). Thus, not only do activins stimulate FSH directly, they have the potential to regulate both FSH and LH indirectly by modulating gonadotrope sensitivity to hypothalamic GnRH. Moreover, activins may negatively regulate their own actions by stimulating the production of one of their principal antagonists. Here, we describe our current understanding of the mechanisms through which activins regulate Fshb, Gnrhr, and Fst transcription in vitro. The activin signaling molecules SMAD3 and SMAD4 appear to partner with the winged-helix/forkhead transcription factor, forkhead box L2 (FOXL2), to regulate expression of all 3 genes. However, in vivo data paint a different picture. Although conditional deletion of Foxl2 and/or Smad4 in murine gonadotropes produces impairments in FSH synthesis and secretion as well as in pituitary Fst expression, Gnrhr mRNA levels are either unperturbed or increased in these animals. Surprisingly, gonadotrope-specific deletion of Smad3 alone or with Smad2 does not impair FSH production or fertility; however, mice harboring these mutations may express a DNA binding-deficient, but otherwise functional, SMAD3 protein. Collectively, the available data firmly establish roles for FOXL2 and SMAD4 in Fshb and Fst expression in gonadotrope cells, whereas SMAD3's role requires further investigation. Gnrhr expression, in contrast, appears to be FOXL2, SMAD4, and, perhaps, activin independent in vivo.

Figure 1.. Schematic representation of activin signaling in murine gonadotrope cells.

Activin B (or a related ligand) produced by gonadotropes acts in autocrine or paracrine fashion to stimulate Fshb, Gnrhr, and Fst transcription. The dimeric ligand binds complexes of type I/type II serine/threonine receptor kinases. ACVR2 and perhaps BMPR2 are the most likely type II receptors in this system. ACVR1B (also known as ALK4) and ACVR1C (ALK7) are the candidate type I receptors. Upon ligand binding, the type II receptors phosphorylate the type I receptors. The type I receptors then phosphorylate the signaling molecules SMAD2 (S2) and SMAD3 (S3). These receptor-regulated SMADs then partner with the common partner SMAD, SMAD4 (S4), and accumulate in the nucleus. According to in vitro models (pictured at the left of the nucleus), these SMAD complexes partner with FOXL2 (F2) to regulate all 3 genes. Left top, In the murine Fshb promoter, SMAD3 partners with FOXL2 at a distal FBE (FBE1); with SMAD2 and SMAD4 at a composite 8-bp SBE (SBEx2); with SMAD4 and FOXL2 at a proximal SBE/FBE3 composite element; and perhaps with paired-like homeodomain transcription factors (PITX or P) at a proximal PITX-binding site. Also, pictured is the location of a composite FBE2/SBE element, which may be unique to the porcine Fshb promoter (see Figure 2). Left middle, SMAD3 partners with DNA-bound SMAD4 and FOXL2 at a composite response element referred to as GRAS to stimulate the murine Gnrhr promoter. An adjacent response element called DARE, which binds LHXs, also mediates activin responsiveness but through currently unknown mechanisms. Left bottom, SMAD3 partners with FOXL2 at an intronic enhancer in the rat Fst gene to mediate its activin induction. SMAD4's role in the response is poorly defined. At the right, The models have been revised to reflect the results of in vivo mouse knockout experiments. Right top, The model of Fshb regulation is largely unchanged, with 2 exceptions: 1) SMAD2 has been removed, and 2) SMAD3 does not need to bind DNA to produce its effects, casting doubt on a role for the 8-bp SBE (SBEx2). Right middle, SMAD4 and FOXL2 do not positively regulate murine Gnrhr. Whether the gene is activin regulated via alternative mechanisms is unclear but appears doubtful. Right bottom, Both FOXL2 and SMAD4 regulate Fst transcription in gonadotropes. The model has been revised to suggest that SMAD4 rather than SMAD3 binds the SBE in the enhancer and the relative location of the FBE is proposed to be directly adjacent to, but 5′ of the SBE (see Figure 3).

Figure 2.. The high-affinity FBE2 is unique to the porcine Fshb promoter.

Bottom, Fshb/FSHB promoter sequences from pig, human, sheep, and mouse were aligned to show the similarities and differences in the composite FBE2/SBE response element. There is a single base pair difference at the first position in pig (T) relative to the other species (C). As described in Ref. , this enables high-affinity binding of FOXL2 to the porcine, but not human, promoter. Top, Replacement of the C with a T (C→T) in human, ovine, and murine FSHB/Fshb promoter reporters confers enhanced activin sensitivity in LβT2 cells. The murine promoter differs at 2 bp from that of the pig in FBE2. Introduction of the porcine base pairs into the murine promoter (CA→TG) confers even greater activin sensitivity than the C→T base pair change alone. The data reflect the means (±SD or SEM) of 2 (human and sheep; n = 2) or 3 (mouse; n = 3) independent experiments, with treatments performed in duplicate or triplicate. Note the break in the y-axis.

Figure 3.. FOXL2 binds regulatory sequences in Fshb, Gnrhr, and Fst.

Nuclear extracts from heterologous Chinese hamster ovary cells expressing murine FLAG-FOXL2 were incubated with a radiolabeled double-stranded probe corresponding to −185/−145 of the porcine Fshb promoter, which contains the high-affinity FBE2 (see Figure 2). As reported previously (43), FOXL2 forms a specific complex with the probe when resolved on a nondenaturing polyacrylamide gel (lane 1; labeled at extreme right). The complex contains FLAG-FOXL2 as indicated by the supershifted complexes observed when antibodies against the FLAG tag (lane 18) or FOXL2 (lane 19) are included in the mix (labeled at right). Binding is dose dependently competed when an unlabeled form of the same probe is included at 50-, 100-, 500-, or 1000-fold molar excess relative to the radiolabeled probe (lanes 2–5). Similarly, unlabeled double-stranded DNA probes containing FBE3 in pig (lanes 6–9) or mouse (lanes 10–13), GRAS from murine Gnrhr (lanes 21–24), the rat Fst intronic enhancer (lanes 25–28), or the Fst enhancer containing mutations in the putative FBE (lanes 33–36) also compete for binding, indicating that they too contain intact FOXL2-binding sites. A probe containing the putative consensus FOXL2-binding site (lanes 14–17) (Ref. 91) fails to compete for binding, suggesting that it lacks a true FOXL2 binding sequence. A Fst enhancer probe containing a mutation in what we predict to be the actual FBE is impaired in its ability to compete for binding (lanes 29–32). Probe sequences (sense strand only) are shown, putative FBEs are underlined, and mutated base pairs are shown in lower case: porcine FBE2, TTATTTTTCCTGTTCCACTGTGTTTAGACTACTTTAGTAAG; porcine FBE3, CCTGTCTATCTAAACACTGATTCACTTACAG; murine FBE3, GCTTGATCTCCCTGTCCGTCTAAACAATGATTCCCTTTCAG; consensus FBE, CCTGTCACGGTCAAGGTCACTATCACTCAC; GRAS, TTTTGTATCTGTCTAGTCACAACAGTTTTT; Fst, GCTGCACGTGTTGTGTCTGGGTCACTGGTAACTGACATTGATATGGCTAG; Fst T->C, GCTGCACGcGTTGTGTCTGGGTCACTGGTAACTGACATTGATATGGCTAG; and Fst FBEmut, GCTGCACGTGTTGTGTCTGGGTCACTGGTAACTGACAcaGcTATGGCTAG.

Figure 4.. Serum FSH is reduced in male mice lacking 2, but not 1, Foxl2 allele in gonadotrope cells.

Blood was collected from 8- to 10-week-old males with 2 intact (floxed) Foxl2 alleles (fx/fx, n = 8), or 1 (Cre+;fx/+, n = 5) or 2 (Cre+;fx/fx, n = 10) Foxl2 alleles selectively deleted in gonadotrope cells. GRIC mice were used as Cre drivers (142). Serum FSH (green) and LH (red) were measured by ELISA at the UVA Ligand Assay Core. Data are mean ± SEM. Note the break in the y-axis.

Figure 5.. GnRHR signaling and expression are activin independent.

A, Intact adult female wild-type or gonadotrope-specific Smad2/3 knockout (S2/3 cKO) mice were treated sc with 3-mg/kg body weight of the GnRHR antagonist, Antide, or with vehicle. After 8 hours, blood was collected and serum LH measured by ELISA. Antide potently suppressed LH release in both genotypes. B, Pituitaries from adult wild-type male and female mice were dispersed and cultured. The next day, cells were treated with the indicated ligands or inhibitors in low serum (2%) medium overnight. RNA was collected; Fshb and Gnrhr mRNA concentrations were determined by RT-qPCR. Data are from a single experiment with treatments performed in quadruplicate (mean ± SEM). Male and female data were comparable and therefore pooled for analysis. Both exogenous activin A and B stimulated Fshb mRNA levels, whereas follistatin-288 and the type I receptor inhibitor, SB431542, abolished Fshb expression. The latter results suggest that an endogenous TGFβ superfamily ligand that signals via ACVR1B, ACVR1C, or TGFBR1 is the main driver of Fshb expression in cultured murine gonadotropes. None of the treatments affected Gnrhr mRNA levels, suggesting that receptor expression is independent of activin signaling, at least in culture and under these experimental conditions.