GONAD: Genome-editing via Oviductal Nucleic Acids Delivery system: a novel microinjection independent genome engineering method in mice

Abstract

Microinjection is considered the gold standard technique for delivery of nucleic acids (NAs; transgenes or genome editing tools such as CRISPR/Cas9 systems) into embryos, for creating genetically modified organisms. It requires sophisticated equipment as well as well-trained and highly skilled personnel to perform the micro-injection technique. Here, we describe a novel and simple microinjection-independent technique, called Genome-editing via Oviductal Nucleic Acids Delivery (GONAD). Using GONAD, we show that NAs (e.g., eGFP mRNA or Cas9 mRNA/sgRNAs) can be effectively delivered to pre-implantation embryos within the intact mouse oviduct by a simple electroporation method, and result in the desired genetic modification in the embryos. Thus GONAD can bypass many complex steps in transgenic technology such as isolation of zygotes, microinjection of NAs into them, and their subsequent transfer to pseudo-pregnant animals. Furthermore, this method can potentially be used for genome editing in species other than mice.

Figure 1. Overview of the Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system.

Figure 2. eGFP expression in the oviducts and embryos following the GONAD procedure.

(a) eGFP fluorescence in the oviducts dissected and analyzed one day after the procedure (from mice B-#05, see Supplementary Table S2). (b) eGFP fluorescence in 8- to 16-cell stage embryos recovered from dissected oviducts shown in (a). The microscopic field shows the representative zygotes with bright (red arrows) and moderate (blue arrows) eGFP fluorescence. (c) eGFP fluorescence in blastocysts derived from embryos in (b) after one day-culturing, showing a normal looking embryo with uniform fluorescence (red box). (d) eGFP fluorescence in morula to blastocyst stage control embryos recovered from a super-ovulated female not subjected to GONAD procedure (B-#09). Scale bars = 1 mm (left side panel in a), 100 μm (right side panels in a, and b to d).

Figure 3. CRISPR/Cas9 - mediated genome editing using the GONAD system (day 13.5 fetuses).

(a) The fetuses were isolated from one mouse at day 13.5 and analyzed for eGFP fluorescence using a fluorescence stereomicroscope. The fetuses 1 and 4 that lost eGFP expression completely (white arrows), the fetuses 2 and 3 exhibited greatly reduced eGFP expression and fetuses 5 and 6 had no loss of eGFP expression. (b) Agarose gel electrophoresis of T7E1-treated PCR products derived from fetuses shown in (a). The red arrows indicate the cleavage products generated in T7E1 assay and the wild-type sized band is indicated by a black arrow. D.W: distilled water used as a negative control. M: 100-bp DNA ladder marker. (c) Direct sequencing of PCR products amplified from the eGFP target region of all six fetuses. The black arrows below the electropherogram (in samples 2 and 3) show overlapping peaks indicative of indel mutations (see text for details). Note that there are three kinds of sequences: clear deletions (samples 1 and 4), mixed indels (samples 2 and 3) and no mutations (samples 5 and 6).

Figure 4. CRISPR/Cas9 - mediated genome editing using the GONAD system (day 19.5 fetuses).

(a) The fetuses were isolated from one mouse at day 19.5 and analyzed for eGFP fluorescence using a fluorescence stereomicroscope. The fetuses 7 and 9 that lost eGFP expression completely (white arrows), the fetus 3 exhibited reduced eGFP expression and other fetuses had no obvious loss of eGFP expression. (b) Agarose gel electrophoresis of T7E1-treated PCR products derived from fetuses shown in (a). The red arrows indicate the cleavage products generated in T7E1 assay and the wild-type sized band is indicated by a black arrow. D.W: distilled water used as a negative control. M: 100-bp DNA ladder marker. (c) Agarose gel electrophoresis of PCR product amplified with primer set (M026: GGTGGTGCAGATGAACTTCAG and #125: CGGGATCCATTGCCTTTTATGGTAATCG) using genomic DNAs isolated from fetus 9 and eGFP transgenic mouse as template. (d) Direct sequencing of PCR products amplified from the eGFP target region of fetuses 3 and 7. The black arrows below the electropherogram show overlapping peaks indicative of indel mutations (see text for details).