G4-associated human diseases

Abstract

Recent research has established clear connections between G-quadruplexes and human disease. Features of quadruplex structures that promote genomic instability have been determined. Quadruplexes have been identified as transcriptional, translational and epigenetic regulatory targets of factors associated with human genetic disease. An expandable GGGGCC motif that can adopt a G4 structure, located in the previously obscure C9ORF72 locus, has been shown to contribute to two well-recognized neurodegenerative diseases, amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). This review focuses on these advances, which further dispel the view that genomic biology is limited to the confines of the canonical B-form DNA duplex, and show how quadruplexes contribute spatial and temporal dimensionalities to linear sequence information. This recent progress also has clear practical ramifications, as prevention, diagnosis, and treatment of disease depend on understanding the underlying mechanisms.

Keywords: ALS; FTD; G4; helicase; quadruplex.

Figure 1

G-quartets, G-quadruplex structures, and formation of G4 DNA during replication or transcription (A) G-quartet, a planar array of four guanines stabilized by pairwise hydrogen-bonding and coordination by a monovalent cation. (B) Antiparallel and parallel G-quadruplexes formed by (GGGGCC)₄. The parallel conformation is observed in RNA formed by this sequence . Underlined G’s participate in G-quartets. G-quartets, green; loops connecting quartets, dotted lines; arrows, 3′ DNA ends. (C) Left, parallel G-quadruplex formed by the human telomeric RNA. Right, structure formed by the long TERRA transcript, containing quadruplexes stacked 5′-5′. Reprinted (adapted) with permission from: Structure of long human telomeric RNA (TERRA): G-quadruplexes formed by four and eight UUAGGG repeats are stable building blocks. Biochemistry 50: 6455–6461. Copyright 2011 American Chemical Society . Notations as in (B). (D) Left, parallel G-quadruplex formed by the core quadruplex of the CEB25 VNTR, d(AAGGGTGGGTGTAAGTGTGGGTGGGT). Right, a “pearl necklace” composed of quadruplexes strung along a chain of unstructured DNA. Reprinted (adapted) with permission from: Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite. J Am Chem Soc 134: 5807–5816. Copyright 2012 American Chemical Society .

Figure 2

Induction of quadruplex structures and potential impact on essential processes (A) Replication, transcription, or local increases in negative superhelicity may expose a single-stranded region bearing a G4 motif, and lead to quadruplex formation. [G4] identifies one or more G4 motifs. G4 RNA may form in the transcript of a gene carrying a G4 motif on the non-transcribed strand (center). (B) A quadruplex may stall replication or transcription, or prevent a sequence-specific transcription factor from recognizing or binding its site in duplex DNA.

Figure 3

Quadruplex targets of regulation (A) Three regions of human genes are G4^hi ([G4]) and thus prone to quadruplex formation: upstream and downstream of the TSS and the 5′ end of intron 1 (right). Quadruplexes upstream and downstream of the TSS are predominant among targets of XPB/XPD, while quadruplexes at the 5′ end of intron 1 are predominant among targets of BLM. (B) Translation of mRNAs containing a quadruplex in the 5′ UTR requires unwinding by the G4 RNA helicase, eIF4, which exposes the ribosome binding site to allow translation. (C) ATRX promotes epigenetic modifications at quadruplexes within G4^hi telomeres and VNTRs.