Orthogonal gene knockout and activation with a catalytically active Cas9 nuclease

Abstract

We have developed a CRISPR-based method that uses catalytically active Cas9 and distinct single guide (sgRNA) constructs to knock out and activate different genes in the same cell. These sgRNAs, with 14- to 15-bp target sequences and MS2 binding loops, can activate gene expression using an active Streptococcus pyogenes Cas9 nuclease, without inducing double-stranded breaks. We use these 'dead RNAs' to perform orthogonal gene knockout and transcriptional activation in human cells.

Figure 1

deadRNAs (dRNAs) can mediate robust gene activation using an active SpCas9. (a) dRNA-mediated gene activation. 15bp dRNA with MS2 loops on the scaffold can bind the MS2-P65-HSF1 (MPH) transcriptional activation complex and activate gene expression without inducing Cas9-mediated DNA indel formation. (b) The length of the RNA targeting sequence was varied from 11nt to 20nt. HBG1 indel frequencies were quantified with (c) HBG1 mRNA levels (normalized to GAPDH, and compared to cells transfected with GFP plasmid). No indel formation was observed when sgRNAs had less than 16bp of homology to target DNA. In all cases, guides were designed with MS2 binding loops in the tetraloops and stemloop two, and were co-transfected with active Cas9 and the MPH transcriptional activation complex. (d) Three dRNAs targeting the promoter regions of IL1B, HBG1, and ZFP42 were tested for activation and indel formation. dRNAs with 14bp or 15bp of homology to target DNA did not induce detectable indel formation. dRNAs co- transfected with Cas9 and MPH activated transcription to a similar extent as 20nt sgRNA-MS2 co-transfected with dCas9 and MPH. (In all cases, mean +/- S.E.M. is plotted. N=2-3 replicates / group). Guide RNAs targeting IL1B, HBG1, and ZFP42 in Figure 1D were derived from the 20bp spacers AAAGGGGAAAAGAGTATTGG, GGCAAGGCTGGCCAACCCAT, and ACCCTGGCGGAGCTGATGGG, respectively

Figure 2

dRNAs can specifically upregulate gene expression, have a specificity profile similar to 20bp sgRNA activators, and can be used for orthogonal gene control in human cells. Sequences targeted to the HBG1/2 promoter were tested for off-target transcriptional activation using RNA-seq. 20nt sgRNAs with MS2 binding loops were co-transfected with dCas9 and the MPH activation complex. These were compared to dRNAs co-delivered with active Cas9 and the MPH activation complex. Both systems showed similar off-target profiles. (a) Zero significantly upregulated genes apart from HBG1/2 were observed for both the 20nt/dCas9 and dRNA/Cas9 treated cells. (b) A second guide showed 55 significantly upregulated genes apart from HBG1/2 for the 20nt/dCas9-treated cells, while 31 significantly upregulated genes were measured for dRNA-treated cells. (In all cases, N=3 replicates / group). (c) Orthogonal gene control in melanoma A375 cells expressing an active Cas9 and the MS2-P65-HSF1 fusion protein. Cells were transduced with lentivirus containing a dRNA targeting one gene and an sgRNA targeting a second gene. Selected cells were subsequently treated with BRAF- inhibitor PLX4720 and their survival was quantified. (d) Activation and indel % were measured for individually and orthogonally controlled genes. Left: LPAR5 transcriptional upregulation mediated by dRNA was robust in the presence and absence of sgRNAs targeting MED12 or TADA2B. Right: LPAR5 indel formation was <= 0.85% at the dRNA target site. (e) Robust indel formation was detected at DNA sites targeted by MED12 and TADA2B sgRNAs alone and when delivered together with a dRNA targeting LPAR5.