N-cadherin functions as a growth suppressor in a model of K-ras-induced PanIN

Abstract

Cadherin subtype switching from E-cadherin to N-cadherin is associated with the epithelial-to-mesenchymal transition (EMT), a process required for invasion and dissemination of carcinoma cells. We found that N-cadherin is expressed in human and mouse pancreatic intraepithelial neoplasia (PanIN), suggesting that N-cadherin may also have a role in early-stage pancreatic cancer. To investigate the role of N-cadherin in mouse PanIN (mPanIN), we simultaneously activated oncogenic K-ras(G12D) and deleted the N-cadherin (Cdh2) gene in the murine pancreas. Genetic ablation of N-cadherin (N-cad KO) caused hyperproliferation, accelerated mPanIN progression, and early tumor development in K-ras(G12D) mice. Decreased E-cadherin and redistribution of β-catenin accompanied the loss of N-cadherin in pancreatic ductal epithelial cells (PDEC). Nuclear accumulation of β-catenin and its transcription co-activator Tcf4 led to activation of Wnt/β-catenin target genes. Unexpectedly, loss of N-cadherin in the K-ras(G12D) model resulted in increased mPanIN progression and tumor incidence. These in vivo results demonstrate for the first time that N-cadherin functions as a growth suppressor in the context of oncogenic K-ras.

Figure 1. E- and N-cadherin expression in human and murine PanIN

Double immunofluorescence analysis of E-cadherin (antibody from Santa Cruz) and N-cadherin (antibody from Invitrogen) in human (A–D) and murine (E, F) pancreas specimens. Pancreas samples were obtained from patients at Johns Hopkins Medical Center (JHMC) following approval by JHMC IRB. E-cadherin was present both in normal pancreatic duct (A) and PanIN (C). By contrast, N-cadherin was absent from normal ducts (B), but found upregulated in a subset of PanIN lesions (D). Arrowheads point to areas shown in merged image (insets). E-cadherin (E) and N-cadherin (F) expression in mPanIN from K-ras^G12D; Pdx1/Cre (KC) mice. Note ductal cells with decreased E-cadherin and increased N-cadherin. Histological analysis of β-galactosidase-stained mPanIN from Ncad^+/+ (G) and Ncad^lacZ/+ (H) KC mice. N-cadherin LacZ reporter showed a positive signal (blue) in ductal cells and islets of Langerhans (Is) in the KC Ncad^lacZ/+ mice (H) whereas KC mice lacking the LacZ reporter served as a negative control (G).

Figure 2. Enlarged pancreata, increased mPanIN lesions and desmoplasia in Ncad KO KC mice

(A) Whole mount images of pancreata from 5- to 6-month old control (Cre minus), Ncad WT, and Ncad KO mice and (B) comparison of pancreas mass (gram) in 6- and 9- to 12-month old mice. *, p<0.05. Transgenic mice were in a mixed genetic background. All mouse experiments were performed under the approval of the Thomas Jefferson University IACUC. Representative pancreas sections from 5- to 6-month old mice stained with H&E (C), Masson trichrome (D), and Alcian blue (E). Representative images of immunohistochemical analysis of PCNA (antibody from Invitrogen) in pancreata from 6-month old control, Ncad WT, and Ncad KO mice (F). (G) Quantification of PCNA nuclear staining. n, number of independent animals examined by immunohistochemistry; **, p<0.01.

Figure 3. Accelerated mPanIN and tumor development in Ncad KO KC mice

(A) Quantification of mPanIN and PDA in 8- to 12-month old Ncad KO (n=26) and WT (n=18) mice. Percent (%) total indicates the ratio of mice that developed mPanIN (highest grade counted) or PDA to the total number of mice. An experienced pancreatic pathologist (CS) reviewed tissue specimens in a blinded fashion. Chi-square analysis showed a significant difference between Ncad KO and Ncad WT KC mice (p < 0.05). (B) Whole-body PET scan using 18F-FDG (Fludeoxyglucose (18F)) on 8-month old control, Ncad WT, and Ncad KO mice. Strong uptake of 18F-FDG was observed in the pancreatic region of Ncad KO mouse (arrow) and absent from control and Ncad WT mice. (C) Whole mount images of the pancreata removed from the PET imaged mice (B). A solid mass was found in the pancreas (arrow) of Ncad KO mouse consistent with PET image. (D) Histological analysis of the pancreata confirmed carcinoma in the Ncad KO and mPanIN in the Ncad WT.

Figure 4. Enhanced β-catenin/Tcf4 activity Ncad KO KC

Immunohistochemical analysis of β-catenin (antibody from Invitrogen) (A) and Tcf4 (antibody from Millipore) (B) expression on adjacent sections of 6-month old control, Ncad WT, and Ncad KO pancreata. Note the corresponding increase in both β-catenin and Tcf4 in cells from adjacent sections in Ncad KO. (C) Quantification of Tcf4-positive nuclei in mPanIN lesions. (D) qPCR of β-catenin/Tcf4 target genes axin2 and MMP7 in pancreata from control (n=3), Ncad WT (n=8), and Ncad KO (n=6) mice. Total RNA was isolated from pancreas tissue disassociated into single cells using RNeasy Mini Kit (Qiagen). Expression of the target gene was compared with the expression level of GAPDH. Primer sequences used were Axin2 forward: 5´ AGCCGCCATAGTC 3´, Axin2 reverse: 5´ GGTCCTCTTCATAGC 3´; MMP7 forward: 5' GCAAGGAGAGATCATGGAGACAGCTT 3', MMP7 reverse: 5' AAGTTCACTCCTGCGTCCTCACCAT 3'; GAPDH forward: 5’ CCACTCTTCCACCTTCGATG 3’, GAPDH reverse: 5’ TCCACCACCCTGTTGCTGTA 3’. (E) Immunoblot analysis of N-cadherin and cyclin D1 (antibody from Santa Cruz) in total protein lysates of PDEC isolated from Ncad WT and Ncad KO mice. (F) Immunoblot analysis of β-catenin in total lysate, cytoplasmic, and nuclear fractions prepared from PDEC isolated from Ncad WT and Ncad KO mice. Lamin B1 (antibody from Abcam) served as a control for enrichment of the nuclear fraction.