EAST Organizes Drosophila Insulator Proteins in the Interchromosomal Nuclear Compartment and Modulates CP190 Binding to Chromatin

Abstract

Recent data suggest that insulators organize chromatin architecture in the nucleus. The best studied Drosophila insulator proteins, dCTCF (a homolog of the vertebrate insulator protein CTCF) and Su(Hw), are DNA-binding zinc finger proteins. Different isoforms of the BTB-containing protein Mod(mdg4) interact with Su(Hw) and dCTCF. The CP190 protein is a cofactor for the dCTCF and Su(Hw) insulators. CP190 is required for the functional activity of insulator proteins and is involved in the aggregation of the insulator proteins into specific structures named nuclear speckles. Here, we have shown that the nuclear distribution of CP190 is dependent on the level of EAST protein, an essential component of the interchromatin compartment. EAST interacts with CP190 and Mod(mdg4)-67.2 proteins in vitro and in vivo. Over-expression of EAST in S2 cells leads to an extrusion of the CP190 from the insulator bodies containing Su(Hw), Mod(mdg4)-67.2, and dCTCF. In consistent with the role of the insulator bodies in assembly of protein complexes, EAST over-expression led to a striking decrease of the CP190 binding with the dCTCF and Su(Hw) dependent insulators and promoters. These results suggest that EAST is involved in the regulation of CP190 nuclear localization.

Fig 1. Immunofluorescent localization of insulator proteins in the nuclei of S2 cells overexpressing EAST or its fragments.

Immunofluorescent localization of insulator proteins in the nuclei of nontransfected S2 cells (control) and S2 cells overexpressing EAST, EAST^1-1995, or EAST^933-2362 tagged with FLAG×3. (A) Immunostaining with antibodies to Su(Hw) (green), Mod(mdg4)-67.2 (Mod-67.2, green), CP190 (red), and FLAG (blue). Scale bars, 5 μm. (B) Immunostaining with antibodies to Su(Hw) (red), Mod(mdg4)-67.2 (Mod-67.2, green), dCTCF C-terminal region (green), and FLAG (blue). Scale bars, 5 μm.

Fig 2. Speckles formed at high and low salt concentrations.

Immunofluorescent localization of insulator proteins in the nuclei of nontransfected S2 cells (control) and S2 cells overexpressing EAST^933-2362 tagged with FLAG×3 (EAST). Immunostaining with antibodies to Su(Hw) (green), CP190 (red), common part of Mod(mdg4) (Mod-Com, blue), and FLAG×3 (blue). Cells were stained in standard SFX medium (isotonic conditions), the same medium diluted fourfold with deionized water (hypotonic conditions), or after treatment with 250 mM NaCl (hypertonic conditions). Scale bars, 5 μm.

Fig 3. Immunofluorescent localization of insulator proteins in the nuclei of S2 cells after EAST knockdown.

EAST RNAi was performed with two sets of primers: one specific for the 5’ end of east transcript (5’ cgtcggcgaagagatgtcta 3’ and 5’ ttgctctgttactgaggaggatgca 3’) and the other, for the middle part of east transcript (5’ taagtcaagcgggaccttgg and 5’ atcccgctgcagaccccat 3’). Nontransfected S2 cells designated as «control» and S2 cells after EAST knockdown by RNAi designated as «EAST RNAi». Immunostaining with antibodies to CP190 (red), Su(Hw) (green), Mod(mdg4)-67.2 (Mod-67.2, green), and common part of Mod(mdg4) (Mod-Com, blue). Dotted line indicates the nucleus boundary (See S5 Fig). Scale bars, 5 μm.

Fig 4. Summary of EAST interactions with insulator proteins in the yeast two-hybrid assay.

(A) The results of testing parts of EAST for the interaction with the Su(Hw), CP190 and Mod(mdg4)-67.2 proteins. The scheme shows the structure of full-length EAST, with light and dark gray shading indicating its unstructured and highly structured regions, respectively. For identification of the different EAST protein signatures, InterProScan tool from EMBL-EBI resource was used. It was found that EAST possesses highly structured middle and C terminal regions, in contrast to the unstructured N terminal region. (B) The results of testing Mod(mdg4)-67.2 domains for the interaction with EAST. The scheme shows Mod(mdg4)-67.2 domains with the numbers of amino acid residues included in the corresponding protein product (in parentheses). (C) The results of testing CP190 domains for the interaction with EAST. The scheme shows CP190 domains with the numbers of amino acid residues included in the corresponding protein product (in parentheses), four C2H2 zinc fingers (white rectangles), and the nuclear localization signal (black bar). Figures in the schemes and on the left are the numbers of amino acid residues. The plus signs indicate the relative strength of two-hybrid interaction; the minus sign, the absence of interaction (See S6 Fig).

Fig 5. The results of tests for EAST interaction with insulator proteins in S2 cells.

(A) Co-immunoprecipitation of V5 epitope-tagged insulator proteins Su(Hw), Mod(mdg4)-67.2 (Mod-67.2), and CP190 by antibodies against the FLAG epitope fused to either EAST or its truncated forms EAST^1-1995 and EAST^933-2362. Immunoprecipitated complexes were washed several times with 150 mM KCl-containing buffers and resolved by SDS-PAGE for Western blot analysis with the indicated antibodies. InPut, input fraction (10% of lysate using for immunoprecipitation); OutPut, supernatant after immunoprecipitation; IP, immunoprecipitate. (B) Co-immunoprecipitation of FLAG-tagged EAST variants by antibodies against the V5 epitope fused to either of the insulator proteins. (C) Co-immunoprecipitation between the insulator proteins and the EAST variants fused in frame with FLAG. The S2 cells were transfected with different EAST truncated proteins fused in frame with FLAG. Immunoprecipitation was performed with antibodies raised to insulator proteins Su(Hw), Mod(mdg4)-67.2 (Mod-67.2), or CP190. The bottom panel (Ab in IP) shows the result of immunoprecipitation of target insulator proteins, which was performed in each assay. (D) Co-immunoprecipitation of Su(Hw), Mod(mdg4)-67.2, and CP190 by antibodies against the FLAG epitope fused to each of the EAST variants.

Fig 6. EAST regulates the binding of insulator proteins to their sites in S2 cells.

(A) ChIP was performed with antibodies against Su(Hw), CP190, Mod(mdg4)-67.2 (the C-terminal region that corresponds to the specific isoform), and Mod-com (the region common to all Mod(mdg4) isoforms) in normal S2 cells (+) and in transfected S2 cells expressing FLAG×3-tagged EAST, EAST^1-1995, or EAST^933-2362. The quantitative PCR (qPCR) was performed on the intergenic and promoter regions bound by Su(Hw). Primers were positioned in the middle of the binding region identified in ModEncode by ChIP-seq. The ras64B coding region (Ras) was used as a control devoid of Su(Hw) binding sites. The percent recovery of immunoprecipitated DNA (Y axis) was calculated relative to the amount of input DNA. Error bars indicate standard deviation of four independent biological replicates. *P ≤ 0.05 (Student’s t-test), in other cases P ≤ 0.01. (B) Results of ChIP with antibodies against CP190, the region common to all Mod(mdg4) isoforms (Mod-com), and dCTCF in normal S2 cells (+) and in transfected S2 cells expressing FLAG×3-tagged EAST, EAST^1-1995 or EAST^933-2362. Quantitative qPCR was performed on the promoter regions of eight genes bound to by dCTCF and CP190 and on the 1A2 insulator. Primers were positioned in the middle of the binding region identified in ModEncode by ChIP-seq. Error bars indicate standard deviation of three independent biological replicates.

Fig 7. Analysis of insulator proteins binding to chromatin after RNAi knockdown of EAST in S2 cells.

ChIP was performed with antibodies against Su(Hw), specific isoform Mod(mdg4)-67.2 (Mod-67.2), and CP190 in normal S2 cells (+) and S2 cells after knockdown of EAST (RNAi EAST). Quantitative qPCR was performed on five Su(Hw)-depended insulator sites and the promoter regions of five genes bound by the Su(Hw) insulator complex. Primers were positioned in the middle of the binding region identified in ModEncode by ChIP-seq. Error bars indicate standard deviation of four independent biological replicates. *P ≤ 0.05 (Student’s t-test), in other cases P ≤ 0.01. Other designations are as in Fig 6.

Fig 8. Role of EAST and CP190 in the expression of genes whose promoters are bound to by the insulator proteins.

(A) Changes in the expression of individual genes after CP190-specific RNAi knockdown in Drosophila S2 cells relative to that after GFP RNAi treatment (taken to be 1). The RpL32 and eh genes that showed no change in expression after the loss of CP190 were used as control. Anti-Tubulin staining (Tub) was used as loading control. The experiments were performed on two samples involving independent RNAi, RNA preparations, and RNA reverse transcription into cDNA. (B) Changes in the expression of individual genes after overexpression of EAST^1-2362, EAST^1-1995, or EAST^933-2362. The experiments were performed on three samples involving independent transfections with a full-length EAST or its fragments, RNA preparations, and RNA reverse transcription into cDNA. Error bars indicate standard deviation of two or three independent biological replicates *P ≤ 0.05 (Student’s t-test), in other cases P ≤ 0.01.