Identification of a Novel Splice Variant Isoform of TREM-1 in Human Neutrophil Granules

Abstract

Triggering receptor expressed on myeloid cells-1 (TREM-1) is critical for inflammatory signal amplification. Humans have two forms of TREM-1: a membrane receptor, associated with the adaptor DAP12, and a soluble receptor detected at times of infection. The membrane receptor isoform acts synergistically with the TLR pathway to promote cytokine secretion and neutrophil migration, whereas the soluble receptor functions as a counterregulatory molecule. In multiple models of sepsis, exogenous administration of soluble forms of TREM-1 attenuates inflammation and markedly improves survival. Despite intense interest in soluble TREM-1, both as a clinical predictor of survival and as a therapeutic tool, the origin of native soluble TREM-1 remains controversial. Using human neutrophils, we identified a 15-kDa TREM-1 isoform in primary (azurophilic) and secondary (specific) granules. Mass spectrometric analysis, ELISA, and immunoblot confirm that the 15-kDa protein is a novel splice variant form of TREM-1 (TREM-1sv). Neutrophil stimulation with Pseudomonas aeruginosa, LPS, or PAM(3)Cys4 resulted in degranulation and release of TREM-1sv. The addition of exogenous TREM-1sv inhibited TREM-1 receptor-mediated proinflammatory cytokine production. Thus, these data reveal that TREM-1 isoforms simultaneously activate and inhibit inflammation via the canonical membrane TREM-1 molecule and this newly discovered granular isoform, TREM-1sv.

Figure 1

Western Blot of human neutrophil fractions using antibody against the TREM-1 Ig-like domain. Positive controls are tagged form of membrane TREM-1 (mb)(Abcam) migrating at 48 kDa and recombinant splice variant TREM-1 (sv) (RnD Systems) migrating at 15 kDa. Neutrophil samples include unfractionated neutrophils (WCL)(45×10⁶ CE) where four TREM-1 species are noted (55kDa, 42kDa, and 24kDa and 15kDa), gamma (γ) fraction (86×10⁶ CE)(42 kD TREM-1 species), beta fraction (β)(111×10⁶ CE)(55kDa and 15kDa species) and alpha fraction (α)(97×10⁶ CE)(55kDa, 24kDa and 15kDa TREM-1 species) respectively. Cell Equivalents (CE) Molecular size ladder (L)(Precision Plus Western Standards,BioRad). Representative blot shown, n=3 independent donors.

Figure 2

Membrane TREM-1 (mbTREM-1) and splice variant TREM-1 (TREM-1sv) transcripts isolated from primary human neutrophils. 1A) mRNA schematic of TREM-1 transcripts: exon 1 (signal sequence, 113 bp, dots), exon 2 (Ig-like domain, 357 bp, black), exon 3 (stalk, 193 bp, white) present in membrane isoform, but not splice variant, exon 4 (terminal region in membrane isoform, 106 bp, stripe, is truncated to 47 bp in splice variant due to a frame shift creating a novel stop codon. 1B) PCR products using forward primer GCAGCCAGAAAGCTTGGCAGATAA and reverse primer ATCCACCAGCCAGGAGAATGACAA (arrows). Primers span the splice region, resulting in a 492 bp product for mbTREM-1 and 299 bp product for TREM-1sv. β actin was used as load control.

Figure 3

TREM-1 identification by mass spectroscopy. To confirm interpretation of spectra from 15 kDa excised band of neutrophil alpha fraction, SDS-Page band of recombinant splice variant TREM-1 was excised and analyzed by LCMSMS under identical conditions. Panel 1 and 2 show 2 different peptides identified in the 15kDa excised band. The predicted trypsin digest peptides with major b- and y- series ions are shown (A) of each panel where b- series are the sequential amino acid residues fragmented from the N-terminus and y- series are fragments starting from the C-terminus. The fragmentation pattern for the neutrophil derived band (B) is shown in comparison to corresponding peptide derived from recombinant TREM-1 (C). Spectra labeled with respective mass to charge (m/z) values in various charge states are shown with assigned b- or y- ions. Sequence interpretation was deemed to be correct because the major b- and y- series ions match.

Figure 4

Detection of mbTREM-1 and TREM-1sv proteins in transfected HEK 293 cells. A. ELISA of whole cell lysates using antibody which recognizes both TREM-1sv and mbTREM-1 isoforms. B. Western Blot of whole cell lysates using antibody which recognizes both TREM-1sv and mbTREM-1 isoforms. C. ELISA of supernatant from transfected HEK 293 cells using antibody generated against TREM-1sv specific peptide. D. Western blot of supernatant using TREM-1sv antibody.

Figure 5

Release of TREM-1sv following in vitro stimulation of human neutrophils. A. TREM-1sv ELISA of neutrophil supernatant from 7 individual donors stimulated with LPS (10ng/ml), heat killed P. aeruginosa, or PAM(3)Cys4 (TLR1/2 agonist). ELISA data were not normally distributed and therefore are expressed in natural log for analysis. Symbols represent individual donors. * indicates p value< 0.05. B. Western blot analysis with anti TREM-1 Ig-like domain antibody of supernatant from unstimulated neutrophils (−) and neutrophils stimulated with P. aeruginosa (+). Recombinant TREM-1sv (SV) used as positive control. Molecular size ladder (L).

Figure 6

TREM-1sv inhibits TREM-1 mediated IL1β release following in vitro stimulation of human neutrophils. IL1β production from human neutrophils treated with control IgG1, media, 21C7 or 21C7 plus TREM-1sv for 18 hours. 3 individual donors * p < 0.05, ** p<0.001, *** p <0.0001.