Distress During Pregnancy: Epigenetic Regulation of Placenta Glucocorticoid-Related Genes and Fetal Neurobehavior

Abstract

Objective: Increased risk of psychopathology is observed in children exposed to maternal prenatal distress, and elevated maternal cortisol and epigenetic regulation of placental glucocorticoid-pathway genes are potential mechanisms. The authors examined maternal distress and salivary cortisol in relation to fetal movement and heart rate ("coupling") and DNA methylation of three glucocorticoid pathway genes-HSD11B2, NR3C1, and FKBP5-in term placentas.

Method: Mood questionnaires and salivary cortisol were collected from 61 women between 24-27 gestational weeks, and fetal assessment was conducted at 34-37 weeks. Placental CpG methylation in the three genes was analyzed using 450K Beadchips and bisulfite sequencing; correlations between maternal and fetal variables and DNA methylation were tested; and maternal distress effects on fetal behavior via DNA methylation were investigated.

Results: Perceived stress (Perceived Stress Scale), but not cortisol, was associated with altered CpG methylation in placentas. In the highest tertile of the Perceived Stress Scale, the Beadchip data revealed modestly elevated methylation of HSD11B2, associated with lower fetal coupling (β=-0.51), and modestly elevated methylation of FKBP5, also with lower fetal coupling (β=-0.47). These increases in methylation were validated by bisulfite sequencing, where they occurred in a minority of clones.

Conclusions: This is the first study to link the effects of pregnant women's distress on the fetus and epigenetic changes in placental genes. Since increased DNA methylation in HSD11B2 and FKBP5 are seen in a minority of bisulfite sequencing clones, these epigenetic changes, and functional consequences, may affect subpopulations of placental cells.

FIGURE 1. Heat Maps of the Spearman Correlation Matrices Between Methylation and Fetal and Maternal Variables^a

^aThe identifiers on the left side of the heat maps are the gene name, followed by the CpG cytosine base pair position in the hg19 assembly of the human genome. In the red-blue scale, white corresponds to zero correlation, purple is a strong negative correlation, and red is a strong positive correlation. In the right panel, the heat map is presented with the threshold of a p value <0.05. In the heat maps, the red boxes indicate the blocks sharing similar correlation patterns of neighboring CpG sites with maternal or fetal variables. Previous studies reported significant associations between methylation patterns in these genes and maternal and/or infant outcomes, identified by the black boxes (30). The previously identified CpG sites show overlapping regions with our identified CpG sites in HSD11B2 and NR3C1, but not in FKBP5. AUC=area under the curve; HAM-A=Hamilton Anxiety Rating Scale; HAM-D=Hamilton Depression Rating Scale; PDQ=Prenatal Distress Questionnaire; PSS=Perceived Stress Scale.

FIGURE 2. Tertiles ofHSD11B2 Promoter Region Methylation in Relation to the Perceived Stress Scale and Fetal Coupling^a

^aThe left graph (A) shows the results for the Perceived Stress Scale. Placentas in the lowest tertile of methylation are associated with lower mean Perceived Stress Scale scores than those in the highest tertile (p=0.0337). The mean Perceived Stress Scale scores are indicated for each tertile of methylation. The right graph (B) shows the results for fetal coupling. Placentas in the lowest tertile of methylation are associated with higher fetal coupling than those in the highest tertile (p=0.0050). For calculating mean methylation values, the fractional methylation values for the 10 queried CpGs in the HSD11B2 promoter* were averaged. The mean coupling values are indicated for each tertile of methylation. The red triangle denotes the donor egg participant. *(cg27130954_16_67464331_HSD11B2, cg02955911_16_67464503_HSD11B2, cg16545496_16_67464522_HSD11B2, cg02322203_16_67464610_HSD11B2, cg08789908_16_67464707_HSD11B2, cg07545640_16_67464829_HSD11B2, cg10686375_16_67464878_HSD11B2, cg12670061_16_67465042_HSD11B2, cg07724674_16_67465455_HSD11B2, cg20981893_16_67465461_HSD11B2).

FIGURE 3. Mediation ofHSD11B2 Methylation on the Association Between Maternal Stress and Fetal Coupling^a

^a The Perceived Stress Scale was negatively associated with fetal coupling through HSD11B2. After controlling for HSD11B2, there remained a positive direct relationship between the Perceived Stress Scale and fetal coupling. ***p<0.001; **p<0.01; *p<0.05.

FIGURE 4. Validation of the Beadchip Data and Fine-Mapping of CpG Methylation in theHSD11B2 Promoter Region Using Bisulfite Sequencing^a

^aThe upper panel shows a map of the gene, including the promoter CpG island (CGI) and the bisulfite sequencing amplicon, which includes Illumina cg16545496 (see Figure 1), as well as 35 surrounding CpGs. The bottom panels show the results of bisulfite sequencing performed on three placentas from pregnancies with low maternal stress (as indicated by Perceived Stress Scale [PSS] values) and three placentas from pregnancies with high maternal stress (each subject’s study number is listed [e.g., 7647_epi058]). Indicated are the fractional methylation values (AVG_Beta) from the Beadchip data for cg16545496 and the percent methylation values from the bisulfite sequencing data over the entire set of 36 CpGs in the amplicon. In bisulfite sequencing, each row is a clone corresponding to one genomic DNA molecule and thus is derived initially from one cell in the placenta. Thus, most placental cells have no DNA methylation in this region, but a minor subpopulation of cells has modest gains of methylation with stress. Open circles=unmethylated CpGs; filled black circles=methylated CpGs. Polymerase chain reaction primer sequences were Forward: TTAGGTTTAAGTTTTGGAAGGAAAG, and Reverse: CTCAAATAAACACATACCACTCAC.