Role of Arabidopsis NHL family in ABA and stress response

Abstract

Based on their sequence homology to Arabidopsis NDR1 and tobacco (Nicotiana tabacum) HIN1, 45 NHL (NDR1/HIN1-like) family genes are found in Arabidopsis genome. Recently, we reported that overexpression of NHL6, a member of NHL family, modulated seed germination under abiotic stresses through affecting ABA biosynthesis and signaling. We also carried out qPCR and investigated the expression of the other 8 member genes (NHL7a, 16, 17, 21, 25, 26, 41, 43) whose transcriptional data are publicly unavailable, and found that expression of NHL17 was induced more than 2 folds in ABA treated seedlings. Furthermore, in addition to the plasma membrane localization, YFP-NHL6 fusion protein was also observed in the cytosol (as dots) or on the membrane of small vacuoles or vesicles. As a member of the pathogen infection related genes, expression of NHL6 was significantly induced by salicylic acid and NHL6s are evolutionarily conserved among different plant species. A working model of NHL6 in ABA response was proposed.

Keywords: ABA; NHL family; NHL6; abiotic stress; gene expression.

Figure 1.

Subcellular localization of YFP-NHL6 and salicylic acid induced expression of NHL6. (A) Subcellular localization of YFP-NHL6 in tobacco leaf epidermal cells. Two small vesicles are indicated by red arrows. Empty YFP vector is used as a control. Bar = 50 μm. (B) cDNA derived from the rosette leaves of 4-week-old Arabidopsis plants treated with 100 µM SA for 12 hours was used as template. qPCR primers for NHL6: forward primer-5′ AACCGTACAATTGTCCACACTCAGG 3′; reverse primer-5′ TTCAGCTCCTTGTCGGTGGTGTT 3′. PR1 (Forward primer-5′AGGCACGAGGAGCGGTAGG3′; reverse primer-5′CTTTGGCACATCCGAGTCTCAC3′) and ACTIN2 (Forward primer-5′GGAAGGATCTGTACGGTAAC3′; reverse primer-5′GGACCTGCCTCATCATACT3′) were employed as positive and native controls, respectively.

Figure 2.

Protein sequence alignment of PtNHL6 (poplar, XP_002318799.1), VvNHL6 (Vitis, XP_002263732.1), MtNHL6 (Medicago, XP_003616105.1), AtNHL6 (Arabidopsis, NP_003022.3), ZmNHL6 (maize, DAA49515.1) and OsNHL6 (rice, NP_001054263.1). The conserved NHL motifs such as motif 1 (LILWLILRPXKPKFXVQDATV), motif2 (NPNKRIGIYYD) and motif 3 (PFYQGHKN) are indicated in black lines above the sequences.

Figure 3.

A proposed working model of NHL6. ABA biosynthesis is induced by salt and mannitol. Upon the binding of ABA to its co-receptors PYR/PRL/RCARs-PP2Cs, the phospatase activity of PP2Cs is inhibited. When the kinase activity of SnRK2s is released from PP2Cs, they phosphorylate and activate AREBs and ABF3. Then, activated AREBs and ABF3 bind to the cis-element ABRE in the promoter of NHL6 and induce its transcription. The internalization of homo-dimerized NHL6 from plasma membrane to the cytosol may also be triggered by salt, mannitol and ABA, to induce endogenous ABA accumulation through up-regulating the expression of ABA biosynthesis genes NCED3, ABA3, AAO2 and AAO3.