Genetic Evolution of a Helicobacter pylori Acid-Sensing Histidine Kinase and Gastric Disease

Abstract

Helicobacter pylori is the strongest risk factor for gastric adenocarcinoma, which develops within a hypochlorhydric environment. We sequentially isolated H. pylori (strain J99) from a patient who developed corpus-predominant gastritis and hypochlorhydia over a 6-year interval. Archival J99 survived significantly better under acidic conditions than recent J99 strains. H. pylori arsRS encodes a 2-component system critical for stress responses; recent J99 isolates harbored 2 nonsynonymous arsS mutations, and arsS inactivation abolished acid survival. In vivo, acid-resistant archival, but not recent J99, successfully colonized high-acid-secreting rodents. Thus, genetic evolution of arsS may influence progression to hypochlorhydia and gastric cancer.

Keywords: H. pylori; acid resistance; hypochlorhydia.

Figure 1.

Patterns of inflammation, colonization, and acid survival induced by archival versus recent Helicobacter pylori J99 isolates. A, Two antral biopsy specimens were obtained at each endoscopy from a single site 2–6 cm from the pylorus on the greater curvature of the stomach and were used for histopathologic examination. Similarly, 2 corpus biopsy specimens were obtained at each endoscopy from a single site 6–10 cm proximal to the termination of the gastric rugae on the greater curvature of the stomach. For each specimen, 10 high-powered fields were examined. Acute and chronic inflammation were each graded 0–3 in the gastric antrum and corpus, for a cumulative score ranging from 0 to 6, and data represent mean histologic scores from the 2 biopsy specimens at each site at each point in time. *P < .05; ^†P < .01. B, Mongolian gerbils were challenged with the H. pylori archival or recent J99 strains. Two weeks after infection, they were euthanized, and their stomachs harvested. One-fourth of the stomach was homogenized in sterile phosphate-buffered saline, as reported elsewhere [10]. After serial dilution, samples were plated on selective trypticase soy agar plates with 5% sheep blood containing vancomycin, nalidixic acid, bacitracin, and amphotericin B and were incubated at 37°C with 5% carbon dioxide for 5–7 days. Colonization efficiency was expressed as the percentage of gerbils colonized versus the percentage gerbils challenged (n = 5 per group). ^‡P = .04. C, Colonization density in wild-type C57Bl/6 mice (n = 5 per group) was determined by means of quantitative culture. ^§P = .008. CFUs, colony-forming units (CFUs). D, Archival and recent J99 strains were cultured in Brucella broth adjusted to a pH of 5.0 or 7.0 and incubated for 60 minutes. Bacteria were then plated by serial dilution, and colonies were counted. ^§P = .008. Abbreviation: NS, not significant.

Figure 2.

The role of arsS in mediating acid survival in archival and recent Helicobacter pylori isolates. A, The arsS sequence from the archival J99 isolate was compared that from the recent J99 isolate, and 2 nonsynonymous point mutations were identified in the recent isolate. At amino acid position 42, cysteine was substituted for arginine, and at position 97, glycine was substituted for tryptophan (red). B, Ribbon diagram of a model of the ArsS sensor domain (residues 41–125). Arrows indicate connections to the putative transmembrane helices of ArsS. Side chains containing residues 42 and 97 are enlarged. C, Changes in H. pylori arsS expression in response to pH 5.0. RNA was isolated from H. pylori grown in broth adjusted to pH 5.0 or 7.0 using the RNeasy RNA purification kit (Qiagen). Reverse-transcriptase polymerase chain reaction (PCR) was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), followed by reverse-transcriptase PCR using the SYBR Green Gene Expression Assay and a 7300 real-time PCR system (Applied Biosystems), with the following primers: arsS, 5′ AAGTGAAACGCTTCGCTCAAG 3′ and 5′ ATTCGTTAGCCAAATCCCCTATT 3′; 16S, 5′ TGCGAAGTGGAGCCAATCTT 3′ and 5′ GGAACGTATTCACCGCAACA 3′. Relative gene expression levels were calculated using the 2^−ΔΔCT method. Levels of arsS expression at pH 5.0 and pH 7.0 were then normalized to levels of 16S messenger RNA expression, and data are represented as the ratio of pH 5.0 to pH 7.0; 3 independent experiments were conducted. †P = .003 (archival vs recent J99). D, Archival and recent wild-type (wt) J99 strains and their arsS isogenic mutants were cultured in Brucella broth that had been adjusted to a pH of 5.0 or 7.0 and then incubated for 60 minutes. Bacteria were then plated by serial dilution, and colonies were counted. *P = .02. Abbreviations: CFUs, colony-forming units; NS, not significant. This figure is available in black and white in print and in color online.