doi: 10.1073/pnas.74.12.5504.
Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron
- PMID: 271973
- PMCID: PMC431782
- DOI: 10.1073/pnas.74.12.5504
Item in Clipboard
Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron
Proc Natl Acad Sci U S A.
1977 Dec.
Abstract
The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.
Similar articles
-
Nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus RNA 4 and its homology with the genomic RNAs.Nucleic Acids Res. 1979 Dec 11;7(7):1887-900. doi: 10.1093/nar/7.7.1887. Nucleic Acids Res. 1979. PMID: 537914 Free PMC article.
-
Complete nucleotide sequence of alfalfa mosaic virus RNA 4.Nucleic Acids Res. 1980 May 24;8(10):2213-23. doi: 10.1093/nar/8.10.2213. Nucleic Acids Res. 1980. PMID: 7433090 Free PMC article.
-
Complete nucleotide sequence of alfalfa mosaic virus RNA 2.Nucleic Acids Res. 1983 May 25;11(10):3019-25. doi: 10.1093/nar/11.10.3019. Nucleic Acids Res. 1983. PMID: 6304618 Free PMC article.
-
Translation of plant virus messenger RNAs.Adv Virus Res. 1979;25:1-91. doi: 10.1016/s0065-3527(08)60568-0. Adv Virus Res. 1979. PMID: 393095 Review. No abstract available.
-
Transfer RNA-like structures in viral genomes.Int Rev Cytol. 1979;60:1-26. doi: 10.1016/s0074-7696(08)61257-7. Int Rev Cytol. 1979. PMID: 387639 Review. No abstract available.
Cited by
-
Yeast deRNA viral transcriptase pause products: identification of the transcript strand.Nucleic Acids Res. 1981 Oct 10;9(19):5049-59. doi: 10.1093/nar/9.19.5049. Nucleic Acids Res. 1981. PMID: 7031603 Free PMC article.
-
Nucleotide sequence of the 3'-noncoding region of alfalfa mosaic virus RNA 4 and its homology with the genomic RNAs.Nucleic Acids Res. 1979 Dec 11;7(7):1887-900. doi: 10.1093/nar/7.7.1887. Nucleic Acids Res. 1979. PMID: 537914 Free PMC article.
-
Analysis of the genome structure of tobacco rattle virus strain PSG.Nucleic Acids Res. 1986 Mar 11;14(5):2157-69. doi: 10.1093/nar/14.5.2157. Nucleic Acids Res. 1986. PMID: 3960718 Free PMC article.
-
Initiation of polypeptide synthesis with various NH2-blocked aminoacyl-tRNAs under the direction of alfalfa mosaic virus RNA 4.Proc Natl Acad Sci U S A. 1977 Dec;74(12):5509-13. doi: 10.1073/pnas.74.12.5509. Proc Natl Acad Sci U S A. 1977. PMID: 341161 Free PMC article.
-
Complete nucleotide sequence of alfalfa mosaic virus RNA 4.Nucleic Acids Res. 1980 May 24;8(10):2213-23. doi: 10.1093/nar/8.10.2213. Nucleic Acids Res. 1980. PMID: 7433090 Free PMC article.
References
Publication types
MeSH terms
Substances
Associated data
- Actions
- Actions
- Actions
LinkOut - more resources
Full Text Sources
