Autophagy promotes ferroptosis by degradation of ferritin

Abstract

Macroautophagy/autophagy is an evolutionarily conserved degradation pathway that maintains homeostasis. Ferroptosis, a novel form of regulated cell death, is characterized by a production of reactive oxygen species from accumulated iron and lipid peroxidation. However, the relationship between autophagy and ferroptosis at the genetic level remains unclear. Here, we demonstrated that autophagy contributes to ferroptosis by degradation of ferritin in fibroblasts and cancer cells. Knockout or knockdown of Atg5 (autophagy-related 5) and Atg7 limited erastin-induced ferroptosis with decreased intracellular ferrous iron levels, and lipid peroxidation. Remarkably, NCOA4 (nuclear receptor coactivator 4) was a selective cargo receptor for the selective autophagic turnover of ferritin (namely ferritinophagy) in ferroptosis. Consistently, genetic inhibition of NCOA4 inhibited ferritin degradation and suppressed ferroptosis. In contrast, overexpression of NCOA4 increased ferritin degradation and promoted ferroptosis. These findings provide novel insight into the interplay between autophagy and regulated cell death.

Keywords: NCOA4; autophagy; ferritin; ferritinophagy; ferroptosis; iron; lipid; pancreatic cancer.

Figure 1.

Autophagy promotes erastin-induced ferroptosis. (A) The indicated immortalized MEFs were treated with erastin and STS for 24 h and cell viability was assayed using a Cell Counting Kit-8 (Sigma, 96992) (n = 3; *, p < 0.05 versus WT group). (B-C) Knockdown of ATG5 and ATG7 by specific shRNA (human ATG5_shRNA sequence: CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG; human ATG7_shRNA sequence: CCGGGCCTGCTGAGGAGCTCTCCATCTCGAGATGGAGAGCTCCTCAGCAGGCTTTTT) inhibited erastin-induced growth inhibition in the indicated human cancer cell lines (n = 3; *, p < 0.05 vs. control shRNA group). (D) Indicated MEFs or HT-1080 cells were treated with erastin for 24 h. Fe²⁺ and MDA levels were assayed using commercial kits (Abcam, ab83366 and ab118970) (n = 3; *, p < 0.05 versus WT group). (E) MEFs and PANC1 cells were treated with erastin “Era” in the presence or absence of CQ for 24 h. Fe²⁺ and MDA levels were assayed using commercial kits (Abcam, ab83366 and ab118970) (n = 3). (F) Western blot analysis monitoring protein expression in MEFs or PANC1 cells following treatment with erastin for 24 h. (G) The indicated MEFs were transfected with a GFP-LC3 plasmid for 24 h and then treated with erastin for 24 h. The GFP-LC3 puncta were assayed using image analysis. (H-I) The effects of knockdown of NCOA4 by shRNA (human NCOA4_shRNA(1) sequence: CCGGTCAGCAGCTCTACTCGTTATTCTCGAGAATAACGAGTAGAGCTGCTGATTTTTG; human NCOA4_shRNA(2) sequence: CCGGTGAACAGGTGGACCTTATTTACTCGAGTAAATAAGGTCCACCTGTTCATTTTTG), or overexpression of NCOA4 by transfection of human NCOA4 cDNA (OriGene Technologies, RC226676) on cell viability, Fe²⁺, MDA, and GSH levels in the indicated cells following treatment with erastin for 24 h (n = 3; *, p < 0.05 vs. control shRNA group or control cDNA group). (J) Schematic of the mechanism by which autophagy promotes ferroptosis.