Minor Antigen Vaccine-Sensitized DLI: In Vitro Responses Do Not Predict In Vivo Effects

Abstract

We reported on a pilot study of minor histocompatibility antigen vaccination using constructs expressing male-specific gene disparities of selected mouse CDNA on Y and sex determining region Y in the canine model. We performed reduced-intensity hematopoietic cell transplantation with female donors and male recipients, producing stable mixed donor-recipient hematopoietic chimeras. We then performed a vaccine series in three female transplant donors followed by donor lymphocyte infusion (DLI) into their respective mixed chimeras. One mixed chimera experienced a significant shift in the percentage of donor chimerism, but no response occurred in the other 2 recipients. We then hypothesized that inadequate donor sensitization was responsible for these results.

Methods: To test this hypothesis, we added 4 monthly booster vaccinations to 2 of the original hematopoietic cell transplantation donors, including the donor that drove the partial response, followed by a second DLI.

Results: Strong T cell responses were shown by ELISpot and confirmed by intracellular cytokine staining in both donors. A second DLI resulted in a further increase in donor chimerism in the same mixed chimera that experienced the previous increase, but no change in donor chimerism was again seen in the other recipient. Evaluation of RNA expression of the target antigens demonstrated that conversion occurred in the recipient that expressed both selected mouse CDNA on Y and sex determining region Y.

Conclusions: T cell responses against Y chromosome-encoded disparities were not necessarily sufficient to drive in vivo female antimale responses. Other factors including the presence of specific haplotypes or the heterogeneous expression of the target antigen may affect T cell responses against minor histocompatibility antigens. These results warrant future vaccine studies in a larger transplant cohort using epigenetic modulation of the recipient to promote target gene expression.

FIGURE 1

Reproduction of published results following unsensitized DLI and miHA-sensitized DLI into eight stable mixed chimeric recipients. The chimerism results were shown as percent donor PBMC on the y axis, with weeks after the DLI shown on the x axis. Eight recipients were infused with unsensitized donor lymphocytes and followed by chimerism analysis (black lines). Eight donors were then sensitized to a miHA via 4 weekly skin grafts from their respective recipients. Eight recipients, 6 of whom had first received an unsensitized DLI, then received a miHA-sensitized DLI 1 week after their respective donor's last skin graft, followed by chimerism analysis (red lines).

FIGURE 3

Determining single peptide responses from within the pooled ELISpot results in both female donors at the time of the second DLI. Pooled ELISpot results at the time of the second DLI for H353 (A) and H592 (B) were shown in the context of a 13 × 13 overlapping peptide pool matrix with the DMSO-negative and phytohemagglutinin-positive control included as a reference. Each column and each row display the peptides included in a pool. D1, D2, and D3 refer to the 3 domains of SMCY encoded within the vaccine; SMCY was dropped from the spreadsheet for space constraints. The P refers to peptide and the number after the P refers to the overlapping peptide, as discussed in the Materials and Methods section. Results were listed either horizontally or vertically with respect to each pool and expressed as average SFC per 10⁶ PBMCs ± standard deviation. Strongly positive pools were highlighted in orange. Individual peptides found at the intersection of 2 strongly positive pools were highlighted in yellow and underwent single peptide ELISpot confirmation for H353 (C) and H592 (D). Two peptides that overlap a negative and positive pool, thus predicted not to elicit a response, were highlighted in red and included in the single peptide analysis. Specific single peptide responses underwent ICS confirmation. A plus sign (+) indicates a positive ICS response and a minus sign (−) indicates a negative ICS response shown in Table 1 and Figure 4. SFC, spot-forming cell.

FIGURE 2

Summary of the pooled ELISpot results in the two donors. The entire treatment schema is shown vertically for donors H353 (A) and H592 (B). The 2 long, vertical arrows plot out time in weeks; the numbers to the left indicate the timing of the various rounds of sensitization and subsequent DLIs; the numbers to the right refer to the time at which the ELISpots were performed. The first long vertical arrow represents the first vaccine regimen and first DLI from the previous study, provided as a reference. The second long vertical arrow, following the six-month interim, depicts the four PMED boost sensitizations and the second DLI. The numbers to the right of the 2 long vertical arrows refer to the time at which the ELISpots were performed and were placed next to the DMSO negative (Neg) control for the ELISpot performed at that time point. Only positive pool responses were shown after the DMSO negative control. Specific pooled peptide responses underwent ICS confirmation. A plus sign (+) indicates a positive ICS response and a minus sign (−) indicates a negative ICS response shown in Table 1 and Figure 4.

FIGURE 4

Three-color intracellular cytokine staining for interferon-γ. The percentage of interferon-γ CD3 + CD4+ T cells of H353 responding to (A) the DMSO-negative control, (B) pool 15, (C) SMCY D2P35, (D) SMCY D2P36, (E) SRY P17, and (F) SRY P18. The percentage of interferon-γ CD3 + CD4+ T cells of H519 responding to (G) DMSO-negative control, and (H) pool 15. The percentage of interferon-γ CD3 + CD8+ T cells of H353 responding to (I) DMSO-negative control, (J) pool 15, and (K) SRY P18. The percentage of interferon-γ CD3 + CD8+ T cells of H519 responding to (L) DMSO-negative control, (M) pool 9, (N) SMCY D3P60, (O) SRY P17, and (P) SRY P18. The remainder of the data is listed in table format (Table 1).

FIGURE 5

The chimerism results were shown as percent donor PBMC (A) and percent donor granulocytes (B) on the y axis, with weeks after the DLI shown on the x axis. The results for the PMED boosting study were labeled “(After second DLI)”, and the chimerism results following the first vaccine study were labeled “(After first DLI).” The chimerism results are shown for recipient H519 after the first DLI (red) and after the second DLI (green).

FIGURE 6

Summary of the pooled ELISpot results for recipient H519. The 2 long horizontal arrows represent the time after each DLI, separated by a 9-month interval. The numbers above the arrows refer to the time after the DLI at which the ELISpots were performed and are placed below the DMSO negative (neg) controls for each time point tested. Only positive pools were shown after the DMSO-negative control from that time. Specific pooled peptide responses underwent ICS confirmation. A plus sign (+) indicates a positive ICS response, and a minus sign (−) indicates a negative ICS response shown in Table 1 and Figure 4.

FIGURE 7

Recipient RNA expression of SMCY and SRY by RT-PCR. Lane 1 was loaded with 100 BP DNA ladder. Lanes 2–5 were loaded with reverse transcribed-PCR products from different primer pairs for SMCY and SRY. Lanes 6 and 7 were loaded with RT-PCR products from primer pairs for the housekeeping genes TBP and TIMM17B. Shown were the RT plus (+) samples for a male control, a female control, and the mixed chimeric recipients that underwent DLI. RT minus controls was performed for each sample (not shown). Positive SRY and SMCY bands were verified by sequencing. The following forward and reverse primers were used for SMCY lane 2 (accaactgcaggctgaaacc/agatctgagccctgcacact), SMCY lane 3 (ctgcaggagccctatcattc/agatctgagccctgcacact), SRY lane 4 (agcctcctcctccatgctat/ttagagtaaaaagaagcgtcagcg), SRY lane 5 (ggtaccagtggaaaatgcttacag/cagctgtccgtgtaggtgaa), TBP lane 6 (gaaatgctgaatataatcccaagc/cagctccccaccatgttct), and TIMM17B lane 7 (atcaagggcttccgcaatg/cacagtcgatggtggagaacag).TBP, TATA-box binding protein; TIMM17B, translocase of inner mitochondrial membrane 17 homology B (yeast).