Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 1995 Jul 1;117(29):7818-7819.
doi: 10.1021/ja00134a032.

Rolling-Circle RNA Synthesis: Circular Oligonucleotides as Efficient Substrates for T7 RNA Polymerase

Sarah L Daubendiek  1 , Kevin Ryan  1 , Eric T Kool  1
Affiliations

Rolling-Circle RNA Synthesis: Circular Oligonucleotides as Efficient Substrates for T7 RNA Polymerase

Sarah L Daubendiek et al. J Am Chem Soc. .
No abstract available

PubMed Disclaimer

Figures

Figure 1
Figure 1
(A) The circular DNA oligonucleotides used as templates for RNA synthesis in this study; “circle nn” refers to a circle which contains the DNA nucleotides shown interrupted by two hexaethylene glycol linkers. (B) The proposed “rolling-circle” mechanism for synthesis of long repeating RNAs from small circular templates.
Figure 2
Figure 2
Autoradiogram from 10% denaturing polyacrylamide gel analysis of products from rolling-circle RNA synthesis and controls. The RNA is internally labeled by [α-32P]UTP incorporation during synthesis. Lane 1: Linear precursor to circle 1 as template (sequence: 5′-pTTTCTTCCTCCTTCTTTCTTTTCCGATCCTTTTC). Lane 2: Circle 1 as template. Lane 3: Circle 1 as template with [UTP] lowered to 1.9 μM. Lanes 4 and 5: Circle 1 as template but with no ATP (4) or no enzyme (5). Lane 6 Circle nn as template. Lane 7: Circle 2 as template. Lane 8: Runoff transcription from linear T7 promoter template (identical conditions): template encodes monomer RNA which appears in multimer from circle 1; template concentration is 1 μM. Standard conditions for rolling-circle reaction: 1 μM circle, 50 units of T7 RNAP (New England Biolabs), 0.5 mM ATP, GTP, CTP, 60 μM UTP, 0.27 μCi of [α-32P]UTP in a pH 8.1 (25 mM Tris·HCI) buffer containing 20 mM NaCl, 15 mM MgCl2. 0.4 mM spermine·4HCl;. 100 μg/mL acetylated bovine serum albumin, 10 mM DTT, and 12.5 units/mL RNase inhibitor (Promega), in a total reaction volume of 15 μL. Reaction time is 1.5 hat 37 °C. and the reaction is stopped by addition of 1 volume of stop solution (30 mM EDTA, 8 M urea) and heating to 90 °C for 2 min, followed by chilling on ice prior to loading on the gel.
See this image and copyright information in PMC

References

    1. Chamberlin MJ. In: RNA Polymerase. Losick R, Chamberlin M, editors. Cold Spring Harbor Press; Cold Spring Harbor: 1976. pp. 17–69.
    2. von Hippel P. H Annu Rev Biophys Biomol Struct. 1992;21:379. - PubMed
    1. Chamberlin M, Ring J. J Biol Chem. 1973;248:2235–2244. - PubMed
    1. Milligan JF, Grcebe DR, Witherell GW, Uhlenbeck OC. Nucleic Acids Res. 1987;15:8783–8798. - PMC - PubMed
    1. Daube SS, von Hippel PH. Science. 1992;258:1320–1324. - PubMed
    2. Daube SS, von Hippel PH. Biochemistry. 1994;33:340–347. - PubMed
    1. Aiyar SE, Helmann JD, deHaseth PL. J Biol Chem. 1994;269:13179–13184. - PubMed

LinkOut - more resources