Cortical interneuron specification: the juncture of genes, time and geometry

Abstract

A fundamental question in developmental neuroscience is how hundreds of diverse cell types are generated to form specialized brain regions. The ganglionic eminences (GEs) are embryonic brain structures located in the ventral telencephalon that produce many inhibitory GABA (γ-Aminobutyric acid)-ergic cell types, including long-range projection neurons and local interneurons (INs), which disperse widely throughout the brain. While much has been discovered about the origin and wiring of these cells, a major question remains: how do neurons originating in the GEs become specified during development as one differentiated subtype versus another? This review will cover recent work that has advanced our knowledge of the mechanisms governing cortical interneuron subtype specification, particularly progenitors' spatial origin, birthdates, lineage, and mode of division.

Figure 1. Each ganglionic eminence produces GABAergic interneurons and projection neurons

A) Image depicting the boundary between the dorsal telencephalon and the ventral telencephalon. The dorsal telencephalon produces excitatory pyramidal cells that migrate short distances radially into the overlying cortex. The ventral telencephalon produces interneurons that travel long and complex migratory routes to various regions throughout the brain. B) Diagram depicting the cell types that each ganglionic eminence (GE) produces and the brain structures they occupy, which includes GABAergic interneurons (red), GABAergic projection neurons (green), and Cholinergic interneurons (dark blue).

Figure 2. SST+ interneurons are born early in the VZ and PV+ interneurons are born late in the SVZ

A) Two models of progenitor lineages in the GEs. Lineages might be restricted to producing particular interneuron subtypes (Model 1), or progenitors’ competencies might change over time to allow numerous lineages to be born in a precise sequence (Model 2). B) Model depicting how clonally related SST+ and PV+ interneurons might be born in the MGE. First an Apical Progenitor (AP) in the VZ gives rise to an SST+ interneuron precursor, and then the AP transitions to a Basal Progenitor (BP) in the SVZ where it produces two PV+ interneuron precursors. Clonality is assessed by infecting progenitors with a unique DNA barcode (e.g. tgactcagagagtctctcactgac) that is passed on to that progenitor’s progeny. C) Graph depicting the temporal order and number of select interneuron subtypes born in the MGE. SST+ interneurons (pink) are born early in the MGE, followed by PV+ interneurons (light blue), which includes Chandelier cells (dark blue).