Detection of Intestinal Pathogens in River, Shore, and Drinking Water in Lima, Peru

Abstract

Water quality management is an ongoing struggle for many locations worldwide. Current testing of water supplies can be time-consuming, expensive, and lack sensitivity. This study describes an alternative, easy-to-use, and inexpensive method to water sampling and testing at remote locations. This method was employed to detect a number of intestinal pathogens in various locations of Lima, Peru. A total of 34 PCR primer pairs were tested for specificity and high-yield amplification for 12 different pathogens using known DNA templates. Select primers for each pathogen were then tested for minimum detection limits of DNA. Water samples were collected from 22 locations. PCR was used to detect the presence of a pathogen, virulence factors, or differentiate between pathogenic species. In 22 water samples, cholera toxin gene was detected in 4.5% of samples, C. perfringens DNA was detected in 50% of samples, E. histolytica DNA was detected in 54.5% of samples, Giardia intestinalis DNA was detected in 4.5% of samples, Leptospira spp. DNA was detected in 29% of samples, and T. gondii DNA was detected in 31.8% of samples. DNA from three pathogens, C. perfringens, E. histolytica, and T. gondii, were found in residential samples, which accounted for 10 out of 22 samples.

Keywords: gel electrophoresis.; polymerase chain reaction (PCR); water sampling; water-borne pathogen detection.

Figure 1

Sampling locations and results. This map shows water sampling locations: along the Rimac River which flows westward (1-11), at a beach site (12) and from residential sink taps in region of Ate (13-21). The key identifies each pathogen found at the different sampling locations. The Sedapal drinking water production facility location is noted along the Rimac River, which causes the volume of water in the river to drop significantly due to water capture. As the river continues following west to the Pacific Ocean, wastewater is the primary source of the river's volume.

Figure 2

Example gel of Leptospira PCR sensitivity and detection. (A) The gel depicts the sensitivity and specificity of the Leptospira 3 primer pair (F)- TAGTGAACGGGATTAGATAC and (R)- GGTCTACTTAATCCGTTAGG, described previously as primers 16S-P1 and 16S-P2.²⁶ The primer pair predicted amplicon length is 110bp. Leptospira DNA from ATCC (Leptospira interrogans serovar Copenhageni Fiocruz L1-130) was diluted in a series of 10-fold dilutions in sets of two, from 1ng (lanes 2 and 3) to 1ag (lane 12 and 13), by using 1X TE buffer. One sample of each set, marked by '*', contained DNA isolated from a local lake in Omaha, Nebraska not known to contain Leptospira, spiked with 1ng of lab cultured isolated Leptospira DNA. (B) The gel depicts PCR results used to determine presence of Leptospira DNA from collected water samples, using the same Leptospira primer pair as above. '+' indicates the positive control (known DNA obtained from ATCC), '-' indicates negative control (primer pair only, no template DNA), and an annealing temperature of 48.5°C was used for used for the PCR cycle. Lanes 1 and 15 contain Fisher exACTgene 100bp ladder. The numbers correspond to samples numbers in Table 2. Presence of Leptospira was identified in samples 1, 4, 5, and 10.