Characterization of two novel intronic OPA1 mutations resulting in aberrant pre-mRNA splicing

Abstract

Background: We report two novel splice region mutations in OPA1 in two unrelated families presenting with autosomal-dominant optic atrophy type 1 (ADOA1) (ADOA or Kjer type optic atrophy). Mutations in OPA1 encoding a mitochondrial inner membrane protein are a major cause of ADOA.

Methods: We analyzed two unrelated families including four affected individuals clinically suspicious of ADOA. Standard ocular examinations were performed in affected individuals of both families. All coding exons, as well as exon-intron boundaries of the OPA1 gene were sequenced. In addition, multiplex ligation-dependent probe amplification (MLPA) was performed to uncover copy number variations in OPA1. mRNA processing was monitored using RT-PCR and subsequent cDNA analysis.

Results: We report two novel splice region mutations in OPA1 in two unrelated individuals and their affected relatives, which were previously not described in the literature. In one family the heterozygous insertion and deletion c.[611-37_611-38insACTGGAGAATGTAAAGGGCTTT;611-6_611-16delCATATTTATCT] was found in all investigated family members leading to the activation of an intronic cryptic splice site. In the second family sequencing of OPA1 disclosed a de novo heterozygous deletion c.2012+4_2012+7delAGTA resulting in exon 18 and 19 skipping, which was not detected in healthy family members.

Conclusion: We identified two novel intronic mutations in OPA1 affecting the correct OPA1 pre-mRNA splicing, which was confirmed by OPA1 cDNA analysis. This study shows the importance of transcript analysis to determine the consequences of unclear intronic mutations in OPA1 in proximity to the intron-exon boundaries.

Keywords: Autosomal dominant optic atrophy; Kjer type optic atrophy; OPA1; Optic neuropathies; Splice site mutation.

Fig. 1

a and b Pedigrees of the described and analyzed ADOA families. Index patients are indicated with an arrow. Black symbols represent affected individuals. Symbols containing ‘n.a.’ (not analyzed) indicate individuals with unknown genotype and/or phenotype (not described in this study). c Sequence analysis of the OPA1 gene at the genomic level. All affected family members of family 1 carrying a heterozygous intronic 22 bp insertion c.611-37_611-38insACTGGAGAATGTAAAGGGCTTT and a 11 bp deletion c.611-6_611-16delCATATTTATCT (indicated with the arrow). d Sequence analysis of OPA1 in the index patient of family 2 discloses a heterozygous intronic 4 bp deletion c.2012+4_2012+7AGTA which was absent in healthy parents and the control

Fig. 2

a Color fundus photography depicting optic disc atrophy of the temporal area is more pronounced in the index patient III:1 of family 1 than in her mother II:2. Corresponding retinal nerve fiber layer thickness analysis by optical coherence tomography demonstrating slight (yellow sectors) to significant reduction (red) in particular within the papillomacular bundle (PMB). b Ophthalmoscopic examination of the index patient II:1 of family 2 demonstrates bilateral temporal optic disc pallor and peripapillary optical coherence tomography demonstrates a thinning of the retinal nerve fibre layer most pronounced in the papillomacular bundle

Fig. 3

Transcript analysis of family 1 (a) and family 2 (b). a All affected relatives of the index patient (III:1) show an additional transcript species compared to the control. b Index patient (II:1) has an additional transcript compared to the control and the healthy parents

Fig. 4

Sequence analysis of OPA1 transcripts. Sequencing of an additional larger transcript species found in the index patient (III:1) identified an activation of a cryptic acceptor splice site leading to the retention of intronic sequence containing an insertion of 22 bp c.611-37_611-38ACTGGAGAATGTAAAGGGCTTT (blue boxes) flanked by intronic sequence (light gray). Red boxes represent the deletion c.611-6_611-16CATATTTATCT. Intronic sequence is written with small letters and exonic sequence with capital letters. (*) indicates the activation of the cryptic splice site, which is located in the wildtype sequence, 166 bp upstream of the canonical splice site. This transcript species was also identified and sequenced in the affected family members (I:2 and II:2) (sequence data not shown)

Fig. 5

Sequence analysis of OPA1 transcripts. Sequencing of the additional smaller transcript species in the index patient (II:1) disclose a skipping of exon 18 and 19. This transcript species was not found in the healthy parents (sequencing data not shown) and the control