Prediction of shorter oligonucleotide sequences recognizing aflatoxin M1

Abstract

Aflatoxin M1 (AFM1) is present in milk of lactating animals fed on aflatoxin B1 contaminated feeds. Aptamers are new emerging ligand molecules and can be employed in assay protocols. Shorter aptamers have several advantages. Untruncated (72-nucleotide long) and truncated (18- to 42-nucleotide long) aptamers were evaluated for AFM1 recognition that was detected by color change in aptamer-conjugated gold nanoparticles in the presence of AFM1. Truncation of 10 aptamers was designed to retain motifs. Untruncated and truncated aptamers recognized AFM1. Binding region on truncated aptamers was predicted by aligning sequences with reported aptamer "ACTGCTAGAGATTTTCCACAT". Aptamer "AFAS3Tr" (ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGA), APM15Tr (CAACGCCAGTCAGTATCTTATATGCTATACTGGCTGGTGTTG), AFA4Tr (AAAA-ACACTATGTAGTGGTGT), AFAM7Tr (CCGGCGGATGCTAATTGCAGAGCAGGTGTGCCGG), and APM6Tr (AAAAATAATTCTAGGTTA) derived from random region of oligonucleotide library had strong homology with 8-nucleotide (ACTGCTAG) sequence at 5^' end of reported aptamer. Comparison of sequence alignment of each of five truncated aptamers with reported sequence has allowed concluding that CTGCTCTGACGCTG in AFAS3Tr, ACGCCAG in APM15Tr, ACTATGTAG in AFA4Tr, TGCTA in AFAM7Tr, AATTCTAG in APM6Tr, and ACTGCTAG in reported aptamer are probable binding regions in aptamers. Truncated aptamers APM15Tr, AFAS3Tr, AFAM7Tr, APM6Tr, AFA4Tr, and predicted shorter nucleotide sequences offer promise for further exploitation in developing sensitive methods for AFM1 measurement.

Keywords: aflatoxin M1; aptamer; binding site; gold nanoparticles; oligonucleotide; truncation.