Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells

Abstract

Optimal approaches to differentiate tumor antigen-specific cytotoxic T lymphocytes (CTLs) from pluripotent stem cells (PSCs) remain elusive. In the current study, we showed that combination of in vitro priming through Notch ligands and in vivo development facilitated the generation of tumor Ag-specific CTLs that effectively inhibited tumor growth. We co-cultured the murine induced PSCs (iPSCs) genetically modified with tyrosinase-related protein 2 (TRP2)-specific T cell receptors with OP9 cell line expressing both Notch ligands Delta-like 1 and 4 (OP9-DL1/DL4) for a week before adoptively transferred into recipient C67BL/6 mice. Three weeks later, B16 melanoma cells were inoculated subcutaneously, and the antitumor activity of the iPSC-derived T cells was assessed. We observed the development of the TRP2-specific iPSC-CD8⁺ T cells that responded to Ag stimulation and infiltrated into melanoma tissues, significantly inhibited the tumor growth, and improved the survival of the tumor-bearing mice. Thus, this approach may provide a novel effective strategy to treatment of malignant tumors.

Keywords: Cytotoxic T lymphocytes; Pluripotent stem cells; immunotherapy; melanoma, mouse.

Figure 1.

Genetic modification of iPSCs with TRP2-specific TCR. Mouse iPSCs were transduced with the MIDR vector or TRP2-specific TCR (MiDR-TCR). (A) Schematic representation of the retroviral construct. (B) GFP⁺ iPSCs (left) were transduced with the retroviral construct MiDR-TCR, and GFP⁺ DsRed⁺ iPSCs (middle) were analyzed by flow cytometry and sorted by a high-speed cell sorter (right). (C) TCR-transduced iPSCs were visualized by fluorescence microscopy (scale bars: 50 μm). (D) GFP⁺ DsRed⁺ iPSCs were sorted and DNA were analyzed for TCR (Vα17 and Vβ11) gene expression by PCR. The forward primer is ATTTTAGATCTCCACCATGCTGATTCTAAGCCTGTTG and the reverse primer is TAAGAATTCTCAGGAATTTTTTTTCTTGAC. Data are representative of three identical experiments.

Figure 2.

In vitro differentiation of TRP2-specific iPSC-CD8⁺ (T)cells. GFP⁺ DsRed⁺ iPSCs were co-cultured with OP9, OP9-DL1, OP9-DL4, or OP9-DL1/DL4 cells for various periods of time, and the cell surface markers were analyzed by flow cytometry. (A) Expression of GFP, CD117, CD117, and CD44 on day 7. (B) Expression of CD19 with CD11b, CD25 with CD44, and CD8⁺ with CD4⁺ on day 28. (C) TCR profiles of SP CD8⁺ cells on day 28. (D) Expression of CD62L, CD127, CD69, CD25, and CD44 on SP CD8⁺ TCRVβ11⁺ cells on day 28. The data shown are representative of three identical experiments.

Figure 3.

Development of TRP2-specific iPSC-CD8⁺ (T)cells by a combination approach of in vitro priming and in vivo differentiation. TRP2-iPSCs were co-cultured with OP9, OP9-DL1, OP9-DL4, or OP9-DL1/DL4 cells for 7 days, and then adoptively transferred into host animals for 3-week in vivo differentiation. (A) Cell numbers of DsRED⁺ populations on various days following co-culture of TRP2-iPSCs with OP9-DL1/DL4 cells for 7 d. Data shown represent mean ( ±SD) counts from three experiments. ***p < 0.0001. (B) Fold changes of numbers of CD117⁺CD44⁺ cells co-cultured with OP9, OP9-DL1, OP9-DL4, or OP9-DL1/DL4 cells for 7 d. Data shown represent mean ( ±SD) counts from three experiments. **p < 0.001). (C) Three weeks after in vivo differentiation, CD8⁺TCRVβ11⁺ cells from the pooled lymph nodes and spleen of mice in different groups were analyzed by flow cytometry, after gating on CD8⁺ T cell population. Data shown are representative of three identical experiments. (D) Three weeks after in vivo differentiation, the pooled lymph nodes and spleen of mice in different groups were stimulated with TRP2_180–188 peptide and analyzed by intracellular cytokine staining (dark lines; shaded areas indicate isotype controls), after gating on CD8⁺ T cells. Data shown are representative of three identical experiments.

Figure 4.

Effective suppression of tumor growth by adoptive transfer of primed TRP2-iPSCs. TRP2-specific iPSC-CD8⁺ T cells were generated as described in Fig. 3. Three weeks after in vivo differentiation, mice were inoculated s.c. with B16 melanoma cells in the flank region. (A) On day 21 and 22 after tumor challenge, tumor tissues were examined for tumor-reactive T cell infiltration. Necrotic tissue and hypocellularity by HE staining (up panel), immunofluorescent staining (middle panel; TRP2-specific TCRVβ11⁺ CD8⁺ T cells in green infiltrated in tumor tissues in black) and by flow cytometry (low panel) (scale bars: 20 μm). Data shown are representative of three identical experiments. (B) Quantitation of tumor necrosis and cell infiltration of CD8⁺ TCRVβ11⁺ DP population in tumor tissue. Data represent mean ( ± SD) counts from six individual mice. *p < 0.05; **p < 0.001. (C) Tumor growth. Data represent mean ( ± SD) tumor volume from six individual mice. One-way ANOVA test was used for statistical analyses between two groups (*p < 0.05). (D) Kaplan–Meier survival curves (n = 6). *p < 0.05; **p < 0.001, One-way ANOVA with Newman–Keuls Multiple comparison test.