MINTbase v2.0: a comprehensive database for tRNA-derived fragments that includes nuclear and mitochondrial fragments from all The Cancer Genome Atlas projects

Abstract

MINTbase is a repository that comprises nuclear and mitochondrial tRNA-derived fragments ('tRFs') found in multiple human tissues. The original version of MINTbase comprised tRFs obtained from 768 transcriptomic datasets. We used our deterministic and exhaustive tRF mining pipeline to process all of The Cancer Genome Atlas datasets (TCGA). We identified 23 413 tRFs with abundance of ≥ 1.0 reads-per-million (RPM). To facilitate further studies of tRFs by the community, we just released version 2.0 of MINTbase that contains information about 26 531 distinct human tRFs from 11 719 human datasets as of October 2017. Key new elements include: the ability to filter tRFs on-the-fly by minimum abundance thresholding; the ability to filter tRFs by tissue keywords; easy access to information about a tRF's maximum abundance and the datasets that contain it; the ability to generate relative abundance plots for tRFs across cancer types and convert them into embeddable figures; MODOMICS information about modifications of the parental tRNA, etc. Version 2.0 of MINTbase contains 15x more datasets and nearly 4x more distinct tRFs than the original version, yet continues to offer fast, interactive access to its contents. Version 2.0 is available freely at http://cm.jefferson.edu/MINTbase/.

Figure 1.

MINTbase, MINTsubmit and the flow of information. We used the MINTmap algorithm to mine nearly 12 000 public datasets for tRFs that we have incorporated in version 2.0 of MINTbase. Users can interact directly with MINTbase. Users can also process their own datasets using MINTmap or other tRF mining tools, such as tDRmapper, tRFfinder, etc. and optionally contribute their findings for inclusion in MINTbase.

Figure 2.

In version 2.0, we incorporated tRF abundance information for all mined tRFs and across all analyzed datasets. The abundance constraints are relevant for and thus available in four of the five available vistas.

Figure 3.

Panel (A) shows the output of a query that is constrained by the keyword ‘TCGA_OV’ and by the minimum RPM value of ‘100’. The 388 tRFs that satisfy the user’s criteria are shown sorted in order of decreasing maximum abundance—see also text. Panel (B) shows the most abundant 3′-tRF aligned to the corresponding parental tRNA template. This tRF is present in 418 of the 499 TCGA_OV datasets. Clicking on the ‘print’ button allows the user to generate a PDF file with the shown alignment.

Figure 4.

A sampling of the diverse information that is available for each tRF in version 2.0 of MINTbase. Panels (A) through (D) provide different aspects of the available information for the 5′-tRF GTCTCTGTGGCGCAATGGAC from tRNA^ArgTCT. See text for more information.