Nitrogen use efficiency is regulated by interacting proteins relevant to development in wheat

Abstract

Wheat (Triticum aestivum) has low nitrogen use efficiency (NUE). The genetic mechanisms controlling NUE are unknown. Positional cloning of a major quantitative trait locus for N-related agronomic traits showed that the vernalization gene TaVRN-A1 was tightly linked with TaNUE1, the gene shown to influence NUE in wheat. Because of an Ala¹⁸⁰ /Val¹⁸⁰ substitution, TaVRN-A1a and TaVRN-A1b proteins interact differentially with TaANR1, a protein encoded by a wheat orthologue of Arabidopsis nitrate regulated 1 (ANR1). The transcripts of both TaVRN-A1 and TaANR1 were down-regulated by nitrogen. TaANR1 was functionally characterized in TaANR1::RNAi transgenic wheat, and in a natural mutant with a 23-bp deletion including 10-bp at the 5' end of intron 5 and 13-bp of exon 6 in gDNA sequence in its gDNA sequence, which produced transcript that lacked the full 84-bp exon 6. Both TaANR1 and TaHOX1 bound to the Ala¹⁸⁰ /Val¹⁸⁰ position of TaVRN-A1. Genetically incorporating favourable alleles from TaVRN-A1, TaANR1 and TaHOX1 increased grain yield from 9.84% to 11.58% in the field. Molecular markers for allelic variation of the genes that regulate nitrogen can be used in breeding programmes aimed at improving NUE and yield in novel wheat cultivars.

Keywords: TaANR1; TaHOX1; TaVRN-A1; flowering time; nitrogen use efficiency (NUE); wheat.

Figure 1

Genetic mapping and phenotypic effects of QNue.osu‐5A. Two sets of the Jagger × 2174 recombinant inbred line (RIL) population were evaluated in a temperature‐ and photoperiod‐controlled greenhouse, and in Kirkland soil that was N‐deficient but adequate in other essential nutrients for 11 weeks. Then, two different levels of N fertilizer (25N and 100N) were supplied to the plants. (a) QTLs for N‐related traits under the 100N condition. The TaVRN‐A1 gene on chromosome 5AL is highlighted in red. (b) QTLs for N‐related traits under the 25N condition. The horizontal dashed line represents a threshold value of 2.5 log of the odds (LOD) for N‐related traits. (c) Phenotypes (heading dates (days from planting)) and genotypes of seven critical recombinant lines with crossovers within the QNue.osu‐5A locus. ‘A’, the Jagger allele; ‘B’, the 2174 allele; and ‘H’, the heterozygous state. Pheno represents phenotypes. Three candidate genes are highlighted in red. ‘X’ indicates a crossover between two neighbouring markers.

Figure 2

Phenotypic effects of TaNUE1 in the field. Several critical recombinant lines were tested in a field at Oklahoma State University Cimarron Valley Research Station in the 2011–2012 growing season. (a) Grain yield. (b) Grains per spike. (c) Biomass. The average values of each genotype in each critical recombinant line were compared, and the bars indicate standard errors. n = 6 for the Jagger allele, and n = 8 for the 2174 allele. Asterisk indicates that the difference was significant between the two alleles (Pr < 0.05).

Figure 3

In vitro interactions between MADS proteins. Ta ANR1 is a protein with MBP‐tag, and Ta VRN‐A1 and Ta AGLG1 are the proteins with HIS‐tag. (a) The protein interaction of Ta ANR1a (60.1 kDa) and Jagger Ta AGLG1a protein (23.79 kDa) or 2174 Ta AGLGb (23.78 kDa). Diamonds represent an area where no interacting proteins are observed between the Ta ANR1a and Ta AGLG1 proteins. (b) The protein interaction of Ta ANR1a with Ta VRN‐A1 (85–191) including both Leu¹¹⁷/Phe¹¹⁷ and Ala¹⁸⁰/Val¹⁸⁰ substitutions. The interacting proteins of Ta ANR1a with the 2174 Ta VRN‐A1b (15.8 kDa) indicated by a star are stronger in protein band intensity than the interacting proteins of Ta ANR1a with the Jagger Ta VRN‐A1a (15.7 kDa) indicated by a triangle. (c) The protein interaction of Ta ANR1a with Ta VRN‐A1 (139–191) including Ala¹⁸⁰/Val¹⁸⁰ substitution only. The interacting proteins of Ta ANR1a with the 2174 Ta VRN‐A1b (9.3 kDa) indicated by a star are stronger in protein band intensity than the interacting proteins of Ta ANR1a with the Jagger Ta VRN‐A1a (9.3 kDa) indicated by a triangle. (d) The protein interaction of Ta ANR1a with Ta VRN‐A1 (85–179) including Leu¹¹⁷/Phe¹¹⁷ substitution only. The interacting proteins of Ta ANR1a with the 2174 Ta VRN‐A1b (14.5 kDa) indicated by a star are similar in intensity than the interacting proteins of Ta ANR1a with the Jagger Ta VRN‐A1a (14.4 kDa) indicated by a triangle. At least three independent replicates were performed for each of these interactions. M indicates a protein marker. (e) Comparison of interacted Ta ANR1 proteins between Ta VRN‐A1a and Ta VRN‐A1b proteins.

Figure 4

In vivo interactions of Ta VRN‐A1 with Ta ANR1 and Ta HOX1. (a–d) In vivo interaction between Ta VRN‐A1a‐pEG201‐YN and Ta ANR1a‐pEG202‐YC proteins, (e–h) In vivo interaction between Ta HOX1a‐YN and Ta ANR1a‐YC proteins. The paired proteins were simultaneously expressed in a living cell in Nicotiana tabacum (tobacco) leaves. (a) and (e) Image of the interacting proteins under a fluorescence microscope with a bright filter (BF). (b) and (f) Image of the interacting proteins under a fluorescence microscope with a green filter. (c) and (g) Image of the nucleus stained with 4′,6‐diamidino‐2‐phenylindole (DAPI). (d) and (h) Overlay images for the alignment of the interacting proteins with the DAPI‐stained nucleus. The scale bar in all images is 50 μm.

Figure 5

Regulation of TaVRN‐A1 by N in normal and transgenic wheat plants. (a) Regulation of TaVRN‐A1 transcript levels by N in Jagger grown in two different soils. (b) TaVRN‐A1 transcript levels in TaVRN‐A1::RNAi transgenic Jagger wheat grown in the Kirkland soil. (c) Heading date of transgenic Jagger wheat grown in the Kirkland soil. TaVRN‐A1::RNAi(+) indicates positive transgenic plants, whereas TaVRN‐A1::RNAi(−) indicates nontransgenic plants. (d) Comparison of typical transgenic positive plants carrying TaVRN‐A1::RNAi(+), and nontransgenic plants of the T20 line at the heading stage. (e) Comparison of a typical transgenic plant carrying TaANR1::RNAi of the T40 line, and wild‐type Jagger plants at the heading stage. (f) Effects of N on TaVRN‐A1 transcript level in the spring wheat cultivar Bobwhite. (g) Effects of N on TaVRN‐A1 transcript level in eight vernalized winter wheat cultivars/lines. The dark columns indicate that N was utilized, whereas the grey columns indicate without N. 1. Jagger; 2. OK12716R/W; 3. OK11D25056; 4. Bentley, 5. Duster; 6. Gallagher; 7. Ruby Lee; 8. IBA; (+N) indicates that N was applied to the plants. Cultivars 1–4 carry the TaVRN‐A1a allele, whereas cultivars 5–8 carry the TaVRN‐A1a allele. (h) Effects of N on heading date in the spring wheat cultivar Bobwhite. Gene transcript levels were calculated using the 2^{(−ΔΔ CT )} method, where CT is the threshold cycle. Primers for TaVRN‐A1 and actin used as an endogenous control are provided in Table S7. The values represent mean expression levels (n = 7–16), and the bar indicates standard error. Asterisk indicates that the difference was significant between the two alleles (Pr < 0.05).

Figure 6

Function of TaANR1 in natural mutant and transgenic plants. (a) Comparison of TaANR1 expression patterns in root and leaf samples between Jagger and 2174. Primers ANR‐MS‐F2 (5′‐GAATGGGTGTCAAGGAACTGCAGG‐3′) and ANR‐MS‐R2 (5′‐GGAGTTCTTGAATTTCGGTTAACTTCAGTCA‐3′) were designed to amplify the 250‐bp Jagger allele and the 166‐bp 2174 allele. (b) A diagram of 23‐bp indel in locations and sequences of TaANR1 between the Jagger and 2174 alleles. The splicing sites at 5′ end (GT) and 3′ end (AG) of intron 5 are highlighted in red. (c) A PCR marker for 23‐bp indel between the Jagger TaANR1a allele and the 2714 TaANR1b allele. Primers ANR‐MF1 (5′‐ATCACAAGGTACTACAACATTTAC‐3′) and ANR‐MR1 (5′‐GGAGTTCTTGAATTTCGGTTAACTTCAGTCA‐3′) were designed to amplify the Jagger allele (286 bp) and the 2174 allele (263 bp). M: DNA marker. (d) Genetic effect of TaANR1 on heading date of RILs in the commercial soil and Kirkland soil. (e) Regulation of TaANR1a transcripts by N and RNAi transgenic wheat. Transcript levels were determined using values calculated by the 2^{(−ΔΔ CT )} method, where CT is the threshold cycle. The values represent mean expression levels (n = 8), and the bars indicate standard errors. (f) Comparison of a typical transgenic plant carrying TaANR1::RNAi and nontransgenic plant at the juvenile stage.

Figure 7

Genetic effects of TaVRN‐A1, TaANR1 and TaHOX1 on grain yield in the field. (a) Genetic effect of three genes on grain yield in recombinant inbred lines (RILs) tested in the field in the 2007–2008 growing season. (b) Genetic effect of three genes on grain yield in RILs tested in the field in the 2014–2015 growing season. The average values of each gene in the population of 96 Jagger × 2174 RILs were compared for two alleles: ‘A’ for those lines (n = 25–58) carrying the Jagger allele, and ‘B’ for those lines (n = 48–61) carrying the 2174 allele. The bars indicate standard errors.