Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comment
. 2018 Jan 2;115(1):E1-E2.
doi: 10.1073/iti0118115. Epub 2017 Dec 12.

Implantation in eutherians: Which came first, the inflammatory reaction or attachment?

Ji-Long Liu  1
Affiliations
Comment

Implantation in eutherians: Which came first, the inflammatory reaction or attachment?

Ji-Long Liu. Proc Natl Acad Sci U S A. .
No abstract available

PubMed Disclaimer

Conflict of interest statement

The author declares no conflict of interest.

Figures

Fig. 1.
Fig. 1.
(A) Volcano plot for the comparison of RNA-seq data between PP and NP. Nonchanged genes are shown in blue, while differently expressed genes (fold-change > 2 and FDR < 0.05) are denoted in red or green. n = 3. (B) Validation of PTGS2 gene expression by quantitative RT-PCR. Data are presented as the mean ± SEM. Primer sequences: PTGS2-Forward: cagatgactgcccaactccc, PTGS2-Reverse: tgaacccaggtcctcgctta; RPL7-Forward: gcagatgtaccgcactgagattc, RPL7-Reverse: acctttgggcttactccattgata. (C) Western blot validation. Antibodies for PTGS2 (D5H5, 74 kDa) and ACTB (D6A8, 45 kDa) were obtained from Cell Signaling Technology.
See this image and copyright information in PMC

Comment in

Comment on

References

    1. Griffith OW, et al. Embryo implantation evolved from an ancestral inflammatory attachment reaction. Proc Natl Acad Sci USA. 2017;114:E6566–E6575. - PMC - PubMed
    1. Genbacev OD, et al. Trophoblast L-selectin-mediated adhesion at the maternal-fetal interface. Science. 2003;299:405–408. - PubMed
    1. Marions L, Danielsson KG. Expression of cyclo-oxygenase in human endometrium during the implantation period. Mol Hum Reprod. 1999;5:961–965. - PubMed
    1. Sun T, et al. Cyclooxygenases and prostaglandin E synthases in the endometrium of the rhesus monkey during the menstrual cycle. Reproduction. 2004;127:465–473. - PubMed
    1. Stewart CL, et al. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature. 1992;359:76–79. - PubMed

LinkOut - more resources