Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus

Abstract

Background: Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome.

Methods and results: A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969)_ME), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969)_ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome.

Conclusions: A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969)_ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.

Keywords: MERS-CoV; Nucleocapsid protein; RNA packaging signal.

Fig. 1

Sequence similarity among the coronavirus genomic RNAs and secondary structure prediction. a Alignment of the whole genome sequence of MERS-CoV (accession number NC_019843.3) with that of SARS-CoV (accession number AY291451.1) and MHV (accession number NC_001846.1) by NCBI blastn. Regions with the highest conservation (alignment score ≧ 200) are indicated by open boxes followed by alignment scores 80–200, 50–80, 40–50, and < 40 as indicated. MERS-CoV RNA fragments spanning nt 19,757 to 20,434 [RNA(19757–20434)] and nt 19,756 to 20,182 [RNA(19756–20182)] with sequence diversity were subjected to secondary structure prediction. b Secondary structure prediction. Secondary structure of MERS-CoV RNA(19757–20434) and RNA(19756–20182) were analyzed by Mfold. Two subdomains of 94-nt (nt 19,801 to 19,894) and 152-nt (nt 20,022 to 20,173) that form stable substructures in both RNA fragments were colored yellow

Fig. 2

Production of MERS VLPs in cultured cells. a Expression of MERS-CoV structural proteins. Plasmids encoding MERS-CoV structural proteins M, E, S, and N as indicated were cotransfected into 293 T cells and the cell lysates were prepared for Western blot analysis two days posttransfection. Protein lysate prepared from cells transfected with control plasmid was applied as a negative control (lane Ctrl). b Electron microscopic analysis of MERS VLPs. The cells were fixed and embedded three days following cotransfection of the plasmids encoding the MERS-CoV structural proteins M, E, and S (VLPdN) or M, E, S, and N (VLP). Images of the sections were examined for the presence of MERS VLPs in a Hitachi H-7100 electron microscope equipped with a Gatan 832 digital camera. c Separation of MERS VLPs. MERS VLPs collected from culture medium were subjected to a discontinuous sucrose gradient centrifugation as described in Methods. The fractions were collected for Western blot analysis. Lane CL represents the protein lysates of transfected cells and lane VLP represents the total VLPs prior to the gradient centrifugation

Fig. 3

Functional analysis of the putative MERS-CoV RNA packaging signal. a-b Expression of MERS-CoV structural proteins in transfected cells and VLPs. Western blot analysis was performed with the cell lysates (panel a) and both the cellular and supernatant VLPs (panel b) following cotransfection of the plasmids encoding the viral structural proteins and a heterologous GFP-PS mRNA as indicated. The secondary structure of the PS258(19712–19969)_ME RNA fragment is shown with the 94-nt stable substructure highlighted as marked in Fig. 1b. c Functional analysis of RNA packaging signal. MERS VLPs were collected from the medium of the cultured cells following cotransfection of the plasmids encoding the viral structural proteins S, E, M, and N, and the GFP vector control plasmid pEGFP-N1 (indicated by VLP), the putative MERS-CoV packaging signal plasmid pEGFP-PS258(19712–19969)ME (indicated by VLP/PS_ME), and the SARS-CoV packaging signal plasmid pEGFP-N1-PS580 (indicated by VLP/PS_SA). VLPdN/PS_ME represents MERSVLPs produced by cotransfection of the plasmids encoding MERS-CoV M, E, and S proteins and plasmid pEGFP-PS258(19712–19969)ME. These MERS VLPs harvested from different cell sources were incubated with naïve Huh7 cells for 48 h. The treated Huh7 cells were then fixed for immunofluorescence staining with GFP antibody and Hoechst

Fig. 4

The RNA binding activity of MERS-CoV N protein. a Purification of the His-tagged MERS-CoV full-length N protein. Following expression of the His-tagged MERS-CoV N protein in E. coli BL21(DE3), the cells were lysed and cell supernatant collected was subjected to protein purification on a nickel-bead affinity column. The His-tagged MERS-CoV N protein eluted by a buffer containing 200 mM imidazole was detected by Coomassie blue staining (top) and Western blot analysis using antibody against the His-tag (bottom). Fractions 2 and 3 were pooled together for the filter binding assay. b Filter binding assay. The interactions between the MERS-CoV N protein and the biotin-SL19805_ME probe were analyzed by the filter binding assay. Unlabeled and 3’ biotin-labeled RNA fragments with sequences 5′–UCCUGCUUCAACAGUGCUUGGACGGAAC–3′ and the predicted structure (as shown) were used as controls for RNA specificity. BSA was used as a protein control

Fig. 5

The RNA binding activity of MERS-CoV N fragments. a Purification of various N fragments. Purification of the full-length (FL) N protein and its subdomains N(1–263), N(264–413), N(1–156), and N(239–413) followed the procedures as described in the legend of Fig. 4. Coomassie blue staining and Western blot analysis are shown. b Schematic representation of the N subdomains and the filter binding assay. The N protein of coronavirus is organized into two structural domains (NTD and CTD) separated by a flexible linker. The NTD structure mainly has an antiparallel β-sheet core domain, whereas the CTD is composed of mainly α-helices [29, 30, 33]. The secondary structural elements are indicated by triangles for β-sheets and cylinders for α-helices, and those shown above the N protein fragments (closed boxes) correspond to the structure of the MERS-CoV N protein, whereas those shown under the boxes correspond to the SARS-CoV N protein. The filter binding assay was conducted with the biotin-SL19805_ME and increasing amounts of the N proteins and BSA control as indicated

Fig. 6

The RNA binding activity of the MERS-CoV N protein on SL19805_ME and SL19893_SA. A filter binding assay was performed with MERS-CoV N proteins and the 50-nt biotin-labeled SARS-CoV RNA (SL19893_SA). The control RNAs and proteins are described in the legend of Fig. 4