Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comment
. 2018 Jun 12;115(24):E5434-E5436.
doi: 10.1073/pnas.1802234115. Epub 2018 May 30.

Transcriptional signature of the decidua in preeclampsia

Ji-Long Liu  1 , Wen-Qian Zhang  2 , Ming-Yu Huang  2
Affiliations
Comment

Transcriptional signature of the decidua in preeclampsia

Ji-Long Liu et al. Proc Natl Acad Sci U S A. .
No abstract available

PubMed Disclaimer

Conflict of interest statement

The authors declare no conflict of interest.

Figures

Fig. 1.
Fig. 1.
(A) Volcano plot for the comparison of RNA-seq data between control and in vitro decidualization (IVD). Nonchanged genes are shown in blue, while differently expressed genes (fold-change > 2 and FDR < 0.05) are denoted in red or green. (B) Validation of PRL and IGFBP1 gene expression by quantitative RT-PCR. The GAPDH gene was used as the reference gene for normalization. Data are presented as the mean ± SEM. Primer sequences: PRL-forward: aagctgtagagattgaggagcaaa; PRL-reverse: tcaggatgaacctggctgacta; IGFBP1-forward: ccaaactgcaacaagaatg; IGFBP1-reverse: gtagacgcaccagcagag; GAPDH-forward: gaaggtgaaggtcggagt; GAPDH-reverse: gatggcaacaatatccactt. (C) PRL and IGFBP1 gene expression upon IVD according to microarray data from Garrido-Gomez et al. (2).
Fig. 2.
Fig. 2.
(A) Overview of genomic studies performed on decidua basalis from preeclampsia patients. Included are Garrido-Gomez et al. (2), Lian et al. (3), Løset et al. (4), and Yong et al. (5). (B and C) Overlap of up-regulated genes and down-regulated genes among these four studies, respectively. Differentially expressed genes shared in two or more studies are labeled on the Venn diagram. (D and E) Overlap of up-regulated genes and down-regulated genes between in vitro decidualization and in vivo decidualization (DB and DP) from Garrido-Gomez et al. (2), respectively.
See this image and copyright information in PMC

Comment in

Comment on

References

    1. Conrad KP, Rabaglino MB, Post Uiterweer ED. Emerging role for dysregulated decidualization in the genesis of preeclampsia. Placenta. 2017;60:119–129. - PMC - PubMed
    1. Garrido-Gomez T, et al. Defective decidualization during and after severe preeclampsia reveals a possible maternal contribution to the etiology. Proc Natl Acad Sci USA. 2017;114:E8468–E8477. - PMC - PubMed
    1. Lian IA, et al. Matrix metalloproteinase 1 in pre-eclampsia and fetal growth restriction: reduced gene expression in decidual tissue and protein expression in extravillous trophoblasts. Placenta. 2010;31:615–620. - PubMed
    1. Løset M, et al. A transcriptional profile of the decidua in preeclampsia. Am J Obstet Gynecol. 2011;204:84.e1–84.e27. - PMC - PubMed
    1. Yong HE, et al. Genome-wide transcriptome directed pathway analysis of maternal pre-eclampsia susceptibility genes. PLoS One. 2015;10:e0128230. - PMC - PubMed

LinkOut - more resources