Chemical modulation of transcription factors

Abstract

Transcription factors (TFs) constitute a diverse class of sequence-specific DNA-binding proteins, which are key to the modulation of gene expression. TFs have been associated with human diseases, including cancer, Alzheimer's and other neurodegenerative diseases, which makes this class of proteins attractive targets for chemical biology and medicinal chemistry research. Since TFs lack a common binding site or structural similarity, the development of small molecules to efficiently modulate TF biology in cells and in vivo is a challenging task. This review highlights various strategies that are currently being explored for the identification and development of modulators of Myc, p53, Stat, Nrf2, CREB, ER, AR, HIF, NF-κB, and BET proteins.

Fig. 1. Crystal structures of TF DNA-binding domains. A) CREB basic leucine zipper (bZIP) homodimer bound to somatostatin cAMP response element (SSCRE) of sequence CCTTGGCTGACGTCAGCCAAG (PDB 1dh3); B) homodimer of the estrogen receptor DNA-binding domain (zinc finger motif) in complex with ER response element of sequence CCAGGTCACAGTGACCTG (PDB ; 1hcq); C) heterodimeric complex of HIF-2α:ARNT(HIF-1β) bHLH motifs bound to hypoxia-response element (HRE) of sequence CACGACCCGCACGTACGCAGC (PDB: ; 4zpk); D) immunoglobulin-like Rel homology domain homodimer of p50 bound to kappaB motif of sequence TGGGAATTCCC (PDB ; 1nfk). The QR codes can be visualized by the app Augment.

Fig. 2. Selected excerpts of TF pathways highlighted within this review, i.e. p53, Nrf2, CREB, and NF-κB.

Fig. 3. Chemical structures of modulators of Myc activity (1–2a/b).

Fig. 4. Crystal structure of MDM2 in complex with a p53-derived peptide (A, yellow, PDB 4hfz) and in complex with small molecule inhibitor 4 (B, purple, PDB ; 4jrg). Both molecules occupy the dimerization site of MDM2:p53 thereby disrupting this interaction (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of p53 (3–6). The QR codes can be visualized by the app Augment.

Fig. 5. Chemical structures of modulators of Stat3 activity (9–11).

Fig. 6. Crystal structure of the Kelch domain of Keap1 in complex with small molecule inhibitors 12 (A, lightblue, PDB ; 4xmb) and 16 (B, slate, PDB ; 5fnu) of the Nrf2–Keap1 interaction. The ligands occupy the solvent exposed pocket responsible for the regulative function of Keap1 (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of Nrf2 activity (12–16). The QR codes can be visualized by the app Augment.

Fig. 7. Chemical structures of modulators of CREB (17–19).

Fig. 8. Crystal structures of the ligand-binding domain (LBD) of the estrogen receptor α (ERα) in complex with full agonist estradiol (A, orange, PDB 1ere) and with the selective ER downregulator AZD9496 (B, 22, dark red, PDB ; 5acc). Depending on the type of ligand bound to the LBD, helix 12 (green) adopts specific conformations (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of ER activity (20–22). The QR codes can be visualized by the app Augment.

Fig. 9. Crystal structures of the ligand-binding domain (LBD) of the androgen receptor in complex with testosterone (A, yellow, PDB 2am9) and with the SARM (R)-bicalutamide (B, 23, purple, PDB ; 1z95). The point mutation W742L allows for bicalutamide to bind to the activated conformation of AR and pre-orients helix H12 (green) for coactivator protein binding (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of AR activity (23–27). The QR codes can be visualized by the app Augment.

Fig. 10. Crystal structures of allosteric HIF-2α inhibitors 28 (A, lightblue, PDB ; 4xt2) and 29 (B, light pink, PDB ; 5ufp) in complex with the HIF-2α PAS-B domain. Both inhibitors occupy the identical binding pocket thereby preventing HIF-2 heterodimerization (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of HIF-2α PAS-B domain (28–29), HIF prolyl hydroxylases (30–32), HIF-1:CREBBP/p300 complex (33), and HIF-1α:pVHL complex (34). The QR codes can be visualized by the app Augment.

Fig. 11. Chemical structures of modulators of NF-κB activity, i.e. IKKβ inhibitor (35), proteasome inhibitors (36–38), covalent Rel protein inhibitor (39), NIK inhibitors (40–41), and c-Rel inhibitor (42).

Fig. 12. Crystal structures of inhibitors JQ1 (A, 43, pink, PDB ; 3oni) and 47 (B, cyan, PDB ; 5j0d) in complex with Brd4 and CREBBP, respectively. The inhibitors occupy an analogous binding pocket thereby preventing binding of Brd4/CREBBP to acetylated lysines (non-interacting side chains are not shown for clarity purposes). C) Chemical structures of modulators of Brd4 (43–45) and CREBBP/p300 bromodomain (46–47). The QR codes can be visualized by the app Augment.

Bianca Wiedemann

Jörn Weisner

Daniel Rauh