Bombyx mori transcription factors FoxA and SAGE divergently regulate the expression of wing cuticle protein gene 4 during metamorphosis

Abstract

Stage-specific gene expression governs metamorphosis of the silkworm, Bombyx mori. B. mori wing cuticle protein gene 4 (BmWCP4) is an essential gene for wing disc development expressed specifically during pupation. BmWCP4 transcription is suppressed at the larval stage by unknown mechanisms, which we sought to elucidate here. Bioinformatics analysis predicted seven potential Forkhead box (Fox) cis-regulatory elements (CREs) in the BmWCP4 promoter region, and we found that Fox CRE6 contributes to suppression of BmWCP4 expression. Electrophoretic mobility shift (EMSA) and DNA pull-down assays revealed that BmFoxA suppressed activity at the BmWCP4 promoter by specifically binding to the Fox CRE6. The expression level of BmFoxA in the wing discs was higher during the larval stage than at the pupal stage. In contrast, expression of another transcription factor, BmSAGE, increased over the course of development. Of note, the hormone 20-hydroxyecdysone (20E), which governs molting in insects, suppressed BmFoxA expression in the wing discs and up-regulated that of BmSage EMSA and cell co-transfection assays indicated that BmSAGE interacted with BmFoxA and suppressed its binding to the Fox CRE6, thereby releasing BmFoxA-mediated suppression of BmWCP4 In summary, higher BmFoxA expression during the larval stage suppresses BmWCP4 expression by binding to the Fox CRE6 on the BmWCP4 promoter. During metamorphosis, BmSAGE forms a complex with BmFoxA to relieve this repression, initiating BmWCP4 expression. Taken together, this study reveals a switchlike role for BmFoxA in regulating BmWCP4 expression and provides new insights into the regulatory regulation of wing disc development in insects.

Keywords: 20-hydroxyecdysone; BmFoxA; BmSAGE; Bombyx mori; DNA-binding protein; Forkhead box A; WCP4; gene expression; gene regulation; metamorphosis; protein-protein interaction; transcription factor; wing cuticle protein.

Figure 1.

Identification and characterization of seven potential Fox CREs in the promoter of BmWCP4 in B. mori. A, location of the seven potential Fox CREs in the upstream promoter of BmWCP4. B, sequence alignment of the seven potential Fox CREs. The conserved nucleotides are indicated with a black background. C, luciferase assay analysis of the effect of the seven potential Fox CREs on the promoter activity of BmWCP4. D, luciferase activity assay for the effect of Fox CRE7M and Fox CRE6M on the BmWCP4 promoter activity. Fox CRE6 and Fox CRE7 in the BmWCP4 promoter were mutated by overlap extension PCR, respectively. The core sequences of Fox CRE6 (AATAATAGGT) and Fox CRE7 (TATAAAAA) were mutated to GGCGGCCGGG and CGCGCGCG, respectively. 1 μg of the Fox CREn-BmWCP4 core promoter-pGL3 constructs and 0.1 μg of pRL-SV40 plasmid DNA were used to transfect the Spli221 cell line. The pRL-SV40 was used as an internal plasmid. The cells were harvested at 48 h post-transfection for the luciferase assay. Each data point is the mean ± S.E. (error bars) of three independent assays. Different letters above the columns indicate significance in the difference of luminescence at p < 0.05 by ANOVA.

Figure 2.

Effects of BmFox protein on the BmWCP4 promoter activity. A, effects of overexpression of BmFox proteins on the expression of reporter luciferase under the control of the regulatory sequences of BmWCP4. 1 μg of the reporter plasmid DNAs (BmWCP4-pGL3), 1 μg of BmFoxn-EGFP plasmid DNA, and 0.1 μg of pRL-SV40 plasmid DNA were used to co-transfect the Spli-221 cell line, respectively. The EGFP plasmid DNA was used as the control, and the pRL-SV40 was used as an internal plasmid. The cells were harvested 48 h post co-transfection for luciferase assays. *, p < 0.05; ***, p < 0.001. B, RNAi reduction of BmFoxA at 48 h after BmFoxA dsRNA was transfected into Spli221 cells. 4 μg of BmFoxA dsRNA was transfected alone or with 2 μg of BmFoxA-EGFP plasmid DNA into Spli221 cells. dsEGFP was used as control. The cells were harvested 48 h after transfection, and the BmFoxA mRNA level was analyzed by qRT-PCR. C, changes of the luciferase activity in Spli221 cells co-transfected with BmFoxA dsRNA or EGFP dsRNA and the luciferase reporter vector. 2 μg of dsBmFoxA were co-transfected with 0.5 μg of BmWCP4 promoter-pGL3-Luc plasmid and BmFoxA-EGFP plasmid into Spli221 cells. The cells were collected 48 h after transfection for luciferase activity analysis. Each data point is the mean ± S.E. (error bars) of three independent assays. Different letters above the columns indicate significance in the difference of luminescence at p < 0.05 by ANOVA.

Figure 3.

Expression pattern and 20E– or JH III–induced expression of BmFoxA in the wing discs. A, Western blot analysis of expression of BmFoxA protein in the wing discs. A total of 30 μg of protein of the wing disc from day 5 of the fifth instar larval stage to adult was used for Western blotting, and β-tubulin was used as a marker for equal protein loading. B, qRT-PCR analysis of induced expression of BmFoxA in the wing discs in the presence of 20E or JH III. 2 μl of a solution of 20E (2 μg/μl) and JHIII (2 μg/μl) were injected into 5-day-old fifth instar larvae at the thoracic region. An equal volume of DMSO at a concentration of 0.1% (v/v) was used as control. After 4 h, the wing discs were dissected in PBS buffer. C, qRT-PCR analysis of induced expression of BmFoxA in BmN cells in the presence of 20E or JH III. BmN cells were treated with JH III or 20E at a final concentration of 1 μm for 4 h, and then the cells were harvested. BmRp49 was used as an internal marker. Each data point is the mean ± S.E. (error bars) of three independent assays. Significance of the differences between the treatment and control was statistically analyzed at p < 0.05 using a t test. nD, day of development; nL, stage of larval instar; W, wandering stage; P, pupal stage.

Figure 4.

Binding analysis of BmFoxA with the Fox CRE6 of the BmWCP4 promoter. A, EMSA of the binding of the nuclear proteins extracted from the BmFoxA-overexpressing spli221 cells with the Fox CRE6 or Fox CRE1. Nuclear proteins were extracted from the BmFoxA-overexpressing Spli221 cells and used to bind with the biotin-labeled Fox CRE6 probe (AATGCTTTAAATAATAGGTATCAGA) and Fox CRE1 probe (TCTGGCACAATGGTTTG), respectively. The cold Fox CRE6 probe was the unlabeled Fox CRE6 probe. For the mutated probe, core sequence of the WT Fox CRE6 was mutated to AATGCTTTAGGCGGCCGGGATCAGA. B, supershift assay analysis of the binding between BmFoxA and the Fox CRE6. Anti-BmFoxA polyclonal antibody was made in a rabbit and used at a dilution of 1:10. IgG was the rabbit serum collected before immune injection of BmFoxA protein. C, EMSA of recombinant His-BmFoxA protein and the Fox CRE6. D, DNA pulldown and Western blot analysis of the nuclear proteins from the BmFoxA-overexpressing spli221 cells. The nuclear protein was incubated with the Fox CRE6 probe or mutant Fox CRE6 probe 4 h at 4 °C, and the elution was analyzed by Western blotting using the anti-BmFoxA polyclonal antibody. E, alignment of Fox CRE6 on BmWCP4 promoter and FoxA CREs of other genes in insects.

Figure 5.

Interaction analysis of BmFoxA and BmSAGE and expression pattern of BmSage in the wing discs at different stages of B. mori. Shown is far-Western blot analysis of the interaction between BmFoxA and BmSAGE. The purified recombinant BmSAGE and SlGST proteins (2 μg) were separated using 12% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were used either for direct immunoblotting using anti-BmFoxA antibody (A) or for far-Western blot analysis (B), where the recombinant BmFoxA was used to incubate with BmSAGE on the membrane before immune detection by anti-BmFoxA antibody. Positive bands were observed when BmFoxA–BmSAGE complex was present. SlGST protein was used as a negative control. C, qRT-PCR analysis of expression pattern of BmSage in the wing discs from day 1 of the fifth instar larval stage to the pupal stage. D, Western blot analysis of the expression of BmSAGE in the wing discs. A total of 30 μg of protein isolated from the wing disc from day 1 of the fifth instar larval stage to day 5 of the pupal stage was used for Western blotting, and β-tubulin was used as a marker for equal protein loading. E, qRT-PCR analysis of 20E-induced expression of BmSage in the wing discs. 2 μl of a solution of 20E (2 μg/μl) were injected into 5-day-old fifth instar larvae at the thoracic region. An equal volume of DMSO at a concentration of 0.1% (v/v) was used as control. After 4 h, the wing discs were dissected in PBS buffer. BmRp49 was used as an internal marker. Each data point is the mean ± S.E. (error bars) of three independent assays. Different letters above the columns indicate significance in the difference of luminescence between the treatments and control at p < 0.05 (*) by ANOVA. Significance of the differences between the treatment and control was statistically analyzed at p < 0.05 using a t test. nD, day of development; nL, stage of instar larvae; W, wandering stage; P, pupal stage.

Figure 6.

BmSAGE relieved the BmFoxA suppression of BmWCP4 expression. A, effect of overexpression of BmFoxA and BmSAGE on the BmWCP4 promoter activity. The vectors of BmFoxA-EGFP, BmSAGE-EGFP, and pGL3 luciferase under the control of the BmWCP4 promoter were used to co-transfect Spli221 cells, and the activity of reporter gene luciferase was measured. Different letters above the columns indicate significance of the differences of luminescence at p < 0.05 by ANOVA. B, ChIP assay of the binding between Fox CRE6 and BmFoxA or BmSAGE. Spli221 cells were transfected with EGFP vector as a control or with BmFoxA-EGFP and BmSAGE, respectively. ChIP target sequences were detected by qRT-PCR. The enrichment of the promoter sequences in immunoprecipitated DNA samples was normalized with DNA present in the 10% input material. Data are means ± S.E. (n = 3). Different letters above the columns indicate significance of the difference of luminescence at p < 0.05 by ANOVA. C, reverse strand sequence of the nt −308 to −267 region of the BmWCP4 promoter. The reverse sequence of Fox CRE6 is boxed in red. D, sequencing atlas of the enriched RT-PCR product of Fox CRE6 in the ChIP assay.

Figure 7.

Schematic representation of the regulation mechanism of the expression of BmWCP4 by BmFoxA and BmSAGE. A, during the larval stage, the highly expressed BmFoxA binds to the Fox CRE6 of the BmWCP4 promoter to suppress the expression of BmWCP4. B, during the pupal metamorphosis, increased 20E suppresses the expression of BmFoxA and increases the expression of BmSAGE. BmSAGE and BmFoxA interact to form a complex and block the binding of BmFoxA to the Fox CRE6, relieving the BmFoxA suppression of the expression of BmWCP4.