Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

Abstract

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Figure 1.

Characterization of a G-quadruplex adopted by kit*. (A) Schematic representation of G-rich region in the promoter of c-KIT gene and its primary sequence. The arrow indicates the transcription start site. (B) Imino region of ¹H NMR spectrum of kit* in the presence of 100 mM KCl, 0.5 mM kit* concentration per strand, pH 7.4 and 37°C on an 800 MHz NMR spectrometer. Assignments are shown above the individual signals. Signals marked with asterisks correspond to pre-kit*. (C) CD spectra of kit* at 4 μM concentration per strand titrated with KCl in 10 mM TRIS, pH 7.5 at 25°C. Arrows indicate changes in CD spectra from 0 mM (black solid line) to 350 mM KCl (black dashed line). (D) Topology of G-quadruplex adopted by kit*. Anti and syn guanines in G-quartets are marked with darker and lighter shades of cyan, respectively.

Figure 2.

Expansions of NOESY spectrum (τ_m 450 ms) of kit*. (A) The aromatic-anomeric region with intra-residue NOE cross-peaks marked with residue numbers. For clarity, only sequential NOE cross-peaks of G1-G2, G6-G7, G11-G12 and G16-G17, characteristic for 5′-syn-anti-3′ steps, are marked with different line styles. (B) NOE cross-peaks between G10 imino and C18 amino protons. (C) Imino-methyl and imino-imino regions. The NMR spectrum was recorded at 0.5 mM kit* concentration per strand, 100 mM KCl, pH 7.4 and 37°C on an 800 MHz NMR spectrometer.

Figure 3.

Fluorescence analysis of exposure of 2-AP in kit* to solvent. (A) Fold-change emission of 2-AP in kit*5–2AP and kit*8–2AP at 370 nm upon addition of 150 mM KCl in 10 mM TRIS, pH 7.5 at 25°C. (B) Fluorescence emission variation of 2-AP in kit*8–2AP upon titration with acrylamide in 10 mM TRIS, pH 7.5, 150 mM KCl at 25°C. (C) Fluorescence emission of kit*5–2AP (black dots) and kit*8–2AP (white triangles) at 370 nm plotted as a function of the concentration of acrylamide.

Figure 4.

Structure of kit* G-quadruplex (PDB ID: 6GH0). (A) An ensemble of ten structures. (B and C) Positions of A5 and T15 above G2-G6-G12-G16 quartet. (D) G10•C18 base pair stacked on G1-G17-G11-G7 quartet. (E) Side and (F) bottom view of the fold-back motif of the 3′-tail and stacking of G10•C18 base pair on G1-G17-G11-G7 quartet. Guanines are shown in cyan and black, adenines in green, cytosines in purple and thymines in orange.

Figure 5.

Imino region of ¹H NMR spectra of (A) modified, (B) 3′-shortened and (C) 5′-extended analogs of kit*. NMR spectra were recorded at ∼0.4 mM concentration of oligonucleotides per strand, 100 mM KCl, pH 7.4 on 800 and 600 MHz NMR spectrometers. Sequences of oligonucleotides are reported in Table 1.

Figure 6.

Temperature-dependent variation between 25 (black solid line) and 95°C (black-dashed line) of CD spectra of (A) kit* and (B) kit*17 in 150 mM KCl. (C) Melting profile of kit* (black dots) and kit*17 (white triangles) monitored at 294 and 264 nm, respectively.

Figure 7.

Imino region of ¹H NMR spectra of kit* and equimolar mixture of kit* and construct c (kit*+c) recorded in the presence of Li⁺ ions at (A) 37 and (B) 5°C as well as (C) in the presence of K⁺ ions at 37°C. (D) Schematic presentation of forms involved in formation of kit* G-quadruplex. Guanines are marked in white, cytosines in black, adenines and thymines in gray.