Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2019 Feb 6;24(3):579.
doi: 10.3390/molecules24030579.

Retro-1-Oligonucleotide Conjugates. Synthesis and Biological Evaluation

Jordi Agramunt  1 , Enrique Pedroso  2 , Silvia M Kreda  3 , Rudolph L Juliano  4 , Anna Grandas  5
Affiliations

Retro-1-Oligonucleotide Conjugates. Synthesis and Biological Evaluation

Jordi Agramunt et al. Molecules. .

Abstract

Addition of small molecule Retro-1 has been described to enhance antisense and splice switching oligonucleotides. With the aim of assessing the effect of covalently linking Retro-1 to the biologically active oligonucleotide, three different derivatives of Retro-1 were prepared that incorporated a phosphoramidite group, a thiol or a 1,3-diene, respectively. Retro-1⁻oligonucleotide conjugates were assembled both on-resin (coupling of the phosphoramidite) and from reactions in solution (Michael-type thiol-maleimide reaction and Diels-Alder cycloaddition). Splice switching assays with the resulting conjugates showed that they were active but that they provided little advantage over the unconjugated oligonucleotide in the well-known HeLa Luc705 reporter system.

Keywords: Retro-1; antisense; oligonucleotide conjugates; splice switching.

PubMed Disclaimer

Conflict of interest statement

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Figures

Scheme 1
Scheme 1
Synthesis scheme described [17] for the preparation of Retro-1, 6. DCM = dichloromethane; NBS = N-bromosuccinimide; TEA = triethylamine. The wavy bond indicates that the stereochemistry is not defined (in other words, the compound is a mixture of isomers).
Scheme 2
Scheme 2
Synthesis of the Retro-1 analogs modified at position 4 of the benzodiazepine ring. The first step (a) afforded the common precursor, which was subsequently modified to obtain either phosphoramidite derivative 9 (b) or the thiol-modified compound 11 (c). CNE = 2-cyanoethyl; DCM = dichloromethane; DIPEA = N,N-diisopropylethylamine; rt = room temperature; TEA = triethylamine; TFA = trifluoroacetic acid; TIS = triisopropylsilane; Trt = trityl. The wavy bond indicates a not defined stereochemistry.
Scheme 3
Scheme 3
Synthesis of diene-derivatized Retro-1 analog 16. ACN = acetonitrile; Boc = tert-butoxycarbonyl; DCM = dichloromethane; diene-COOH = (4E)-4,6-heptadienoic acid; DIPC = N,N’-diisopropylcarbodiimide; Fmoc = 9-fluorenylmethoxycarbonyl; NMM = N-methylmorpholine; on = overnight; rt = room temperature. The wavy bond indicates a not defined stereochemistry.
Scheme 4
Scheme 4
Solid-phase assembly of conjugates 19. B = G (oligonucleotide a)/T (oligonucleotide b); BTT = 5-benzylthio-1H-tetrazole; CNE = 2-cyanoethyl; PS = phosphorothioate. The wavy bond indicates a not defined stereochemistry.
Scheme 5
Scheme 5
Preparation of conjugates 22 and 23. B = G (oligonucleotide a)/T (oligonucleotide b); BTT = 5-benzylthio-1H-tetrazole; CNE = 2-cyanoethyl; MW = microwave; PS = phosphorothioate. The wavy bond indicates a not defined stereochemistry.
Figure 1
Figure 1
HeLa705 cells in complete growth medium were incubated for 16 h with various concentrations of conjugated or unconjugated oligonucleotide. Thereafter the cells were recovered and assayed for luciferase activity. In one case cells were post-treated with 10 μM UNC7938 for 4 h after exposure to SSO623 and then assayed. RLU = relative luminescence units; n = 3. Means and standard errors shown. SSO623: r5’GTTATTCTTTAGAATGGTGC3’, all 2’-O-Me and phosphorothioate (PS) (T = ribothymidine).
Figure 2
Figure 2
Analytical HPLC trace of crude 11 (detection wavelength: 250 nm).
Figure 3
Figure 3
Analytical HPLC traces of crude 16 (top), purified diastereomer 1 (bottom, left) and purified diastereomer 2 (bottom, right). Detection wavelength: 250 nm. Top trace, tR ~ 2–3 min: 15 & N,N’-diisopropylurea.
Figure 4
Figure 4
Analytical HPLC trace of oligonucleotide r5’GTTATTCTTTAGAATGGTGC3’. Detection wavelength: 250 nm.
Figure 5
Figure 5
Analytical HPLC trace of oligonucleotide r5’TGTGTACTGATGTAGTTATC3’. Detection wavelength: 250 nm.
Figure 6
Figure 6
HPLC trace of crude (left) and purified (right) conjugate 19a. Detection wavelength: 254 nm.
Figure 7
Figure 7
HPLC trace of crude (left) and purified (right) conjugate 19b. Detection wavelength: 254 nm. Left trace, tR ~ 19 min: r5’TGTGTACTGATGTAGTTATC3’.
Figure 8
Figure 8
HPLC traces of crude (left) and purified (right) oligonucleotide 21a. Detection wavelength: 254 nm.
Figure 9
Figure 9
HPLC traces of crude (left) and purified (right) oligonucleotide 21b. Detection wavelength: 254 nm. Left trace, tR ~ 19 min: r5’TGTGTACTGATGTAGTTATC3’.
Figure 10
Figure 10
HPLC traces of crude (left) and purified (right) conjugate 22a. Detection wavelength: 254 nm.
Figure 11
Figure 11
HPLC traces of crude (left) and purified (right) conjugate 23a. Detection wavelength: 254 nm.
Figure 12
Figure 12
HPLC traces of crude (left) and purified (right) conjugate 23b. Detection wavelength: 254 nm. Left trace, tR ~ 18 min: 16.
See this image and copyright information in PMC

References

    1. Zamecnik P.C., Stephenson M.L. Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proc. Natl. Acad. Sci. USA. 1978;75:280–284. doi: 10.1073/pnas.75.1.280. - DOI - PMC - PubMed
    1. Juliano R.L. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016;44:6518–6548. doi: 10.1093/nar/gkw236. - DOI - PMC - PubMed
    1. Shen X., Corey D.R. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs. Nucleic Acids Res. 2018;46:1584–1600. doi: 10.1093/nar/gkx1239. - DOI - PMC - PubMed
    1. Sharma V.K., Sharma R.K., Singh S.K. Antisense oligonucleotides: Modifications and clinical trials. Med. Chem. Commun. 2014;5:1454–1471. doi: 10.1039/C4MD00184B. - DOI
    1. Crooke S.T., Witzum J.L., Bennett C.F., Baker B.F. RNA-targeted therapeutics. Cell Metab. 2018;27:714–739. doi: 10.1016/j.cmet.2018.03.004. - DOI - PubMed

Substances