Persistent mutant oncogene specific T cells in two patients benefitting from anti-PD-1

Abstract

Background: Several predictive biomarkers are currently approved or are under investigation for the selection of patients for checkpoint blockade. Tumor PD-L1 expression is used for stratification of non-small cell lung (NSCLC) patients, with tumor mutational burden (TMB) also being explored with promising results, and mismatch-repair deficiency is approved for tumor site-agnostic disease. While tumors with high PD-L1 expression, high TMB, or mismatch repair deficiency respond well to checkpoint blockade, tumors with lower PD-L1 expression, lower mutational burdens, or mismatch repair proficiency respond much less frequently.

Case presentation: We studied two patients with unexpected responses to checkpoint blockade monotherapy: a patient with PD-L1-negative and low mutational burden NSCLC and one with mismatch repair proficient colorectal cancer (CRC), both of whom lack the biomarkers associated with response to checkpoint blockade, yet achieved durable clinical benefit. Both maintained T-cell responses in peripheral blood to oncogenic driver mutations - BRAF-N581I in the NSCLC and AKT1-E17K in the CRC - years after treatment initiation. Mutation-specific T cells were also found in the primary tumor and underwent dynamic perturbations in the periphery upon treatment.

Conclusions: These findings suggest that T cell responses to oncogenic driver mutations may be more prevalent than previously appreciated and could be harnessed in immunotherapeutic treatment, particularly for patients who lack the traditional biomarkers associated with response. Comprehensive studies are warranted to further delineate additional predictive biomarkers and populations of patients who may benefit from checkpoint blockade.

Keywords: Checkpoint blockade; Neoantigens; Oncogene; Predictive biomarkers; T cells.

Fig. 1

Durable clinical benefit to PD-1 blockade in two patients without high mutational burden tumors. a, Patient LUAD-3001 – a 76 year old woman with metastatic non-small cell lung cancer. Selected cropped IV contrast enhanced CT images of the chest in lung window at four different timepoints. Baseline exam (11/25/13) demonstrates two left lower lobe solid nodules with surrounding ground glass opacities (red arrows) compatible with metastases. First followup exam while on nivolumab (2/10/14) demonstrates near complete resolution with minimal residual ground glass opacities (red arrows). Additional two and four year followup exams (7/14/16 and 2/21/18) demonstrate complete and durable resolution of metastases, with no evidence of progression elsewhere in the body (not shown). b, H&E staining (left panel), PD-L1 staining (center panel), and CD8 infiltration (right panel) of the primary tumor obtained from patient LUAD-3001 during surgical resection on 4/12/2012. c, Patient CRC-010 - a 69 year old woman with metastatic recurrent mismatch repair proficient colorectal cancer with locally invasive pancreatic metastasis. Selected IV contrast enhanced CT images of the abdomen in venous phase. Baseline exam (12/27/13) demonstrates a heterogeneous hypovascular mass with scattered calcifications (red arrow). Four month follow up exam on pembrolizumab (4/2/14) demonstrates slight enlargement without new metastases. Metastasis slowly decreased in size on 2 year follow up (2/23/16) and slightly increased on four year follow up exam (9/29/17). No new metastases are seen on interval or latest CT exam and disease remains stable. d, H&E staining (left panel), PD-L1 staining showing no expression on tumor cells (red arrow, center left panel) but high expression at the invasive front on a discrete immune cell aggregate and CD8 infiltration (center right panel) in the primary tumor obtained from patient CRC-010 during surgical resection on 9/29/2003. CD8 staining demonstrating a brisk CD8⁺ lymphocytic infiltrate is also shown on a fine needle aspiration of the pancreatic recurrence on 12/30/2013 (right panel)

Fig. 2

T-cell recognition of BRAF N581I mutation in lung cancer patient LUAD-3001 responding to anti-PD-1 treatment. Individual 10-day peptide-stimulated cultures identified persistent mutation associated neoantigen-specific clonotypes (described in methods) detectable in the blood of patient LUAD-3001 > 2 years after complete tumor regression following PD-1 blockade. a Three clonotypes recognized the A*02:01-restricted BRAF N581I-derived IIFLHEDLTV peptide neoantigen (LUAD 26, left panel). The TGCAGTGTGAGAGCAGACAGGGGGGAAAATTCACCCCTCCACTTT clonotype was detected in the original resected tumor (center panel), whereas all three clonotypes were detected in serial peripheral blood samples obtained before and after PD-1 blockade (right panel). Data are shown as the number of cells detected after the 10 day culture (abundance) for cultured cells and the relative frequency (%) of each clonotype among all cells detected by TCRseq for FFPE tumor tissue and serial peripheral blood samples. b Duplicate binding assays were performed on the putative neoantigen and wild type counterpart, as well as the known MART1 mutant HLA A*02:01-restricted ELAGIGILTV epitope. Data are shown as mean counts per second, with error bars representing the standard deviation. c The lollipop plot shows the position of the patient’s BRAF N581I mutation among the other oncogenic mutations within the BRAF gene; green: missense mutations, black: truncating mutations, brown: inframe mutations, purple: other

Fig. 3

T-cell recognition of AKT1 E17K mutation in MMRp CRC-010 with stable disease after anti-PD-1 treatment. Individual 10-day peptide-stimulated cultures identified long-lived mutation associated neoantigen-specific clonotypes (described in methods) detectable in the blood of patient CRC-010 3 years after developing stable disease following PD-1 blockade: a The TGTGCCAGCAGTGACTCCTGGGGCGCGGATGGCTACACCTTC clonotype, which recognized the HLA-A*23:01-restricted AKT1 E17K-derived KYIKTWRPRYF peptide neoantigen (CRC8, left panel), was detected in the original resected tumor (center panel) and expanded in the periphery upon pembrolizumab treatment (right panel). Data are shown as the number of cells detected after the 10 day culture (abundance) for cultured cells and the relative frequency (%) of each clonotype among all cells detected by TCRseq for FFPE tumor tissue and serial peripheral blood samples. b Duplicate binding assays were performed on the putative neoantigen and wild type counterpart, as well as the known HLA A*23:01-restricted EBV PYLFWLAAI epitope as a positive control. Data are shown as mean counts per second, with error bars representing the standard deviation. c The lollipop plot shows the position of the patient’s AKT1 E17K mutation among the other oncogenic mutations within the AKT1 gene; green: missense mutations, black: truncating mutations, brown: inframe mutations, purple: other