First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease

Abstract

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.