Tricho-hepatic-enteric syndrome (THES) without intractable diarrhoea

Abstract

Tricho-hepatic-enteric syndrome (THES) is a genetically heterogeneous rare syndrome (OMIM: 222470 (THES1) and 614602 (THES2)) that typically presents in the neonatal period with intractable diarrhoea, intra-uterine growth retardation (IUGR), facial dysmorphism, and hair and skin changes. THES is associated with pathogenic variants in either TTC37 or SKIV2L; both are components of the human SKI complex, an RNA exosome cofactor. We report an 8 year old girl who was diagnosed with THES by the Undiagnosed Disease Program-WA with compound heterozygous pathogenic variants in SKIV2L. While THES was considered in the differential diagnosis, the absence of protracted diarrhoea delayed definitive diagnosis. We therefore suggest that SKIV2L testing should be considered in cases otherwise suggestive of THES, but without the characteristic diarrhoea. We expand the phenotypic spectrum while reviewing the current knowledge on SKIV2L.

Keywords: Next generation sequencing; RNA exosome; SKI complex; SKIV2L; Undiagnosed.

Fig. 1.

Sanger sequencing chromatograms for DNA from the proband and her parents. The trio analysis indicates occurrence of the SKIV2L variants in trans in the proband. Primers used for targeted amplification and sequencing of the gene regions containing the SKIV2L variants are as follows: Forward TGGGTCTGAGGGGAAGAAAG and reverse GATCTGACCTCTGGCCAATAG (exon 9) for NM_006929.4:c.904C>T, and forward GTTGCTTCCTGATTCCTGCCC and reverse CACTACAACCCCACCACTTC (exon 22) for NM_006929.4:c.2662_2663delAG.

Fig. 2.

Illustration depicting characteristic features associated with THES.