Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2019 Feb 27;7(5):707-714.
doi: 10.3889/oamjms.2019.128. eCollection 2019 Mar 15.

Phenotypic Identification and Molecular Characterization of Malassezia Spp. Isolated from Pityriasis Versicolor Patients with Special Emphasis to Risk Factors in Diyala Province, Iraq

Affiliations

Phenotypic Identification and Molecular Characterization of Malassezia Spp. Isolated from Pityriasis Versicolor Patients with Special Emphasis to Risk Factors in Diyala Province, Iraq

Ahmed Kamil Awad et al. Open Access Maced J Med Sci. .

Abstract

Aim: The main objective is isolation and molecular characterisation of Malassezia spp. from pityriasis versicolor (PV) patients with special emphasis to risk factors in Diyala province, Iraq.

Methods: Fifty patients (32 males and 18 females) presented with PV, the age ranged (15-45) years were included. Direct wet mount using KOH 10%, culture of skin scraping and PCR were used for confirmatory diagnosis.

Results: Malassezia spp. was isolated from (54%) of skin scraping; M. furfur (32%); M. pachydermatis (8%) and M. globosa (14%). The age group (15-22) years were frequently exposed to Malassezia infection. A significant inverse correlation was reported between age and exposure to Malassezia spp. Infection. Males were frequently exposed to Malassezia infection, (40%). A significant correlation was reported between gender and exposure to Malassezia spp. Infection. Females were at risk of getting Malassezia infection (2.619) time than males. Patient resident in the urban area frequently exposed to Malassezia infection, (34%). Patients resident in the rural area appears to be at risk of getting Malassezia infection (1.093) time than those in an urban area. Patient with good economic status was frequently exposed to Malassezia infection, (36%). Patients with middle economic status appear to be at risk of getting Malassezia infection (0.42) time than those with good economic status. Patients with primary education were frequently exposed to Malassezia infection, (22%). A significant correlation was reported between education level and exposure to Malassezia spp. Infection. No significant correlation was reported between economic status; type of job; source of water; contact with dogs and birds and Malassezia spp. Infection.

Conclusion: M. furfur, M. pachydermatis and M. globosa represent the most common Malassezia spp. causing PV. Using of PCR is very critical to confirm the diagnosis of Malassezia spp. Malassezia infection inversely correlated with age and positively correlated with females gender and education. The residency in a rural area and middle economic status increase the possibility of infection. Infection was not affected by the source of water; job and contact with dogs and birds.

Keywords: Iraq; Malassezia spp; Molecular diagnosis; Pityriasis versicolor; Risk factors.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Agarose gel electrophoresis (2%) for 100 v/mAmp for 80 min of Malassezia spp. DNA products generated through ITS 3 (GCATCGATGAAGAACGCAGC), and ITS4 (TCCTCCGCTTATTGATATGC) primers, stained with Ethidium bromide; M: Molecular marker (100bp); lanes 1H, 2H, 3H: M. furfur (509bp); lanes H4: M. globosa (430bp); lanes H5: M. pachydermatis (483bp)

References

    1. Inamadar AC, Palit A. The genus Malassezia and human disease. Indian Journal of Dermatology, Venereology, and Leprology. 2003;69(4):265. - PubMed
    1. Gaitanis G, Magiatis P, Hantschke M, Bassukas ID, Velegraki A. The Malassezia genus in the skin and systemic diseases. Clinical microbiology reviews. 2012;25(1):106–41. https://doi.org/10.1128/CMR.00021-11. - PMC - PubMed
    1. Varada S, Dabade T, Loo DS. Uncommon presentations of tinea versicolor. Dermatology practical &conceptual. 2014;4(3):93. https://doi.org/10.5826/dpc.0403a21. - PMC - PubMed
    1. Dawson T. The human skin microbiome:cause or effect?The role of Malassezia in human skin health and disease. Medical Mycology Oxford Univ Press Great Clarendon St, Oxford Ox2 6dp, England. 2018
    1. Rai M, Wankhade S. Tinea versicolor–an epidemiology. J Microbial Biochem Technol. 2009;1(1):51–6. https://doi.org/10.4172/1948-5948.1000010.

LinkOut - more resources