Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Zhifeng Lin¹, Liwen Xiong², Qiang Lin³

Affiliations

¹ Department of Thoracic Surgery, Shanghai First People's Hospital, Shanghai Jiaotong University, No. 100 HaiNing Road, Shanghai, 200080, China.
² Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiaotong University, 241 West Huaihai Road, Shanghai, 200030, China.
³ Department of Thoracic Surgery, Shanghai First People's Hospital, Shanghai Jiaotong University, No. 100 HaiNing Road, Shanghai, 200080, China. LinqiangPhD@163.com.

PMID: 31053950
DOI: 10.1007/s12032-019-1276-y

Published Erratum

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Zhifeng Lin et al. Med Oncol. 2019.

. 2019 May 3;36(6):53.

doi: 10.1007/s12032-019-1276-y.

Authors

Zhifeng Lin¹, Liwen Xiong², Qiang Lin³

Affiliations

¹ Department of Thoracic Surgery, Shanghai First People's Hospital, Shanghai Jiaotong University, No. 100 HaiNing Road, Shanghai, 200080, China.
² Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiaotong University, 241 West Huaihai Road, Shanghai, 200030, China.
³ Department of Thoracic Surgery, Shanghai First People's Hospital, Shanghai Jiaotong University, No. 100 HaiNing Road, Shanghai, 200080, China. LinqiangPhD@163.com.

PMID: 31053950
DOI: 10.1007/s12032-019-1276-y

Abstract

The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".

PubMed Disclaimer

Erratum for

Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer.
Lin Z, Xiong L, Lin Q. Lin Z, et al. Med Oncol. 2018 Aug 18;35(10):130. doi: 10.1007/s12032-018-1178-4. Med Oncol. 2018. PMID: 30121714 No abstract available.

Publication types

Actions

LinkOut - more resources

Full Text Sources
- Springer

Save citation to file

Email citation

Add to Collections

Add to My Bibliography

Your saved search

Create a file for external citation management software

Your RSS Feed

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Affiliations

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Authors

Affiliations

Abstract

Erratum for

Publication types

LinkOut - more resources

Full Text Sources