Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Editorial
. 2019 Nov;17(11):2023-2025.
doi: 10.1111/pbi.13152. Epub 2019 Jun 6.

Foot rot tolerant transgenic rough lemon rootstock developed through expression of β-1,3-glucanase from Trichoderma spp

Jagdeep Singh Sandhu  1 , Shivani Nayyar  1 , Ajinder Kaur  1 , Ramanjeet Kaur  1 , Anu Kalia  2 , Anita Arora  3 , Yesmin Kaur  4 , Surinder Kumar Thind  4 , Gautam Chhabra  1
Affiliations
Editorial

Foot rot tolerant transgenic rough lemon rootstock developed through expression of β-1,3-glucanase from Trichoderma spp

Jagdeep Singh Sandhu et al. Plant Biotechnol J. 2019 Nov.
No abstract available

Keywords: Phytophthora parasitica; hyphal structural degradation; scanning electron microscopy; transgenic rootstock.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Foot rot tolerant transgenic rough lemon rootstock. (a) Map of gene cassette carrying 1764‐bp β‐1,3‐glucanase catalytic domain (KJ603460). (b) In vitro‐raised seedling. (c) Epicotyl segment. (d) Direct regeneration. (e) Root formation. (f) T0 plants. (g) Semi‐quantitative RT‐PCR using catalytic domain primers 5ꞌ‐ATGTTGAAGCTCACGGCGCTCGTTG‐3ꞌ and 5ꞌ‐ACTCGATTGCAGGGAAAGGCGGA‐3ꞌ (top panel), RL‐5 to RL‐165 denote transgenic plants; cDNA integrity using 26SrRNA primers 5ꞌ‐CACAATGATAGGAGGAGCCGAC‐3ꞌ and 5ꞌ‐CAAGGGAACGGGCTTGGCAGAATC‐3ꞌ (AY283368) [bottom panel]. (h) Phytophthora mycelial growth inhibition by transgenic plant proteins; growth inhibition (%) = [(growth in NT ˗ growth in RL)/growth in NT] × 100; the assay was performed in triplicate; results are presented as mean ± SE. (i) Swollen hyphae; numbers indicate hyphal thickness. (j) Hyphal cytoplasmic constrictions with beaded appearance (solid arrows, bracket) and termination of mycelial branches (broken arrow). (k) Hyphal fragmentation; arrows indicate break points. (l) Normal unswollen hyphae. (m) Phytophthora‐inoculated NT plant displaying gumming symptoms. (n) Inoculated transgenic plant RL‐78 with the absence of gumming. (o) Estimation of foot rot incidence and plant morphological parameters: †Gumming scale 0–4, where 0 = nil, 1 = slight gumming, 2 = moderate gumming, 3 = severe gumming, 4 = tree girdled; leaf chlorosis scale 0–3, where 0 = no symptoms, 1 = chlorotic leaves (light symptoms), 2 = necrotic leaves (moderate symptoms), 3 = wilt and defoliation (severe symptoms); ‡feeder root rot scale 1–5, where 1 = no visible symptoms, 2 = a few roots (1–25%) with rotting symptoms, 3 = majority of roots (26–50%) with rotting symptoms, 4 = all roots infected (51–75% rotting), major roots dead, 5 = majority of roots (>76% rotting) dead or missing; §propagule count was mean of three replicates; ††trunk girth was assessed at 20 cm above ground; ¶¶plant height was measured from ground to highest point; ‡‡canopy volume = 0.5236 × plant height × canopy spread (north to south) × canopy spread (east to west); §§feeder root volume = mean feeder root volume/total soil volume, where total soil volume = 141.14 cc [Π × (radius of cylinder 1.59 cm)2 × height of cylinder 17.78 cm]; plant morphological parameters were recorded thrice, and P < 0.05 was statistically significant. (p) Quantitative RT‐PCR in leaves, roots of transgenic plants before and after Phytophthora inoculation using qRT‐PCR β‐1,3‐glucanase primers 5ꞌ‐CTCTCCAGAATGCTATCACCAC‐3ꞌ and 5ꞌ‐GGTATATGTTCCCGGAGGAATG‐3ꞌ; 18SrRNA reference gene primers 5ꞌ‐TCGGGTGTTTTCACGTCTCA‐3ꞌ and 5ꞌ‐TGGATGCCGCTGGGAAGC‐3ꞌ (FJ356261.1); error bars represent range of change in β‐1,3‐glucanase expression determined by 2−∆∆C T method. (q) Transverse root section of susceptible NT plant revealing the occurrence of ligni‐tubers (solid arrows) and callose deposition (broken arrows) in cortex cells. (r) The absence of ligni‐tubers and callose deposition in cortex cells of tolerant plant RL‐78. (s) The occurrence of zoospores on side wall (solid arrow) and end plate (broken arrow) of root xylem cell from susceptible NT plant. (t) The absence of zoospores in xylem cells of tolerant plant RL‐78. (u) Endophytic microbial cell count in roots of transgenic rough lemon plants inoculated with Phytophthora; the microbial cell count (103 cfu/mL) was recorded in triplicate, and results are presented as mean ± SE. (v) Allelic pattern using CCSM‐17 (5ꞌ‐ACATGGACAGGACAACTAAG‐3ꞌ and 5ꞌ‐GTTATGATACGTCTGTGTTCC‐3ꞌ); arrows indicate the presence of additional allele, RL‐5 to RL‐78 denotes transgenic plants, M refers to mother plant, B represents blank lane, L denotes 100‐bp DNA ladder (Promega, Cat. No. G2101), and N indicates nucellar plant. (w) CCSM‐6 (5ꞌ‐ATCTGTGTGAGGACTGAA‐3ꞌ and 5ꞌ‐CCTCTATTAATGTGCCTG‐3ꞌ); arrows depict the absence of allele. (x) CCSM‐13 (5ꞌ‐CTAGAGCCGAATTCACC‐3ꞌ and 5ꞌ‐AACAGCTACCAAGACACC‐3ꞌ); arrows show the absence of allele. (y) CCSM‐18 (5ꞌ‐GTGATTGCTGGTGTCGTT‐3ꞌ and 5ꞌ‐AACAGTTGATGAAGAGGAAG‐3ꞌ); arrows specify the absence of alleles.
See this image and copyright information in PMC

References

    1. Bartnicki‐Garcia, S. (1966) Chemistry of hyphal walls of Phytophthora . J. Gen. Microbiol. 42, 57–69. - PubMed
    1. Benítez, T. , Rincón, A.M. , Limón, M.C. and Codón, A.C. (2004) Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 7, 249–260. - PubMed
    1. van den Berg, N. , Christie, J.B. , Aveling, T.A.S. and Engelbrecht, J. (2018) Callose and β‐1,3‐glucanase inhibit Phytophthora cinnamomi in a resistant avocado rootstock. Plant. Pathol. 67, 1150–1160.
    1. Castle, W.S. (2010) A career perspective on citrus rootstocks, their development and commercialization. HortScience, 45, 11–15.
    1. Castresana, C. , Carvalho, F.D. , Gheysen, G. , Habets, M. , Inze, D. and Montagu, M.V. (1990) Tissue‐specific and pathogen‐induced regulation of a Nicotiana plumbaginifolia β‐1,3‐glucanase gene. Plant Cell, 2, 1131–1143. - PMC - PubMed

Publication types

Substances

LinkOut - more resources