Lentiviral Mediated Gene Silencing in Human Pseudoislet Prepared in Low Attachment Plates

Abstract

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, the data obtained from rodent islets are often not fully reproduced in or applicable to human islets due to well-known differences in islet structure and function between the species. Currently, techniques that are available to manipulate gene expression of human islets are very limited. Introduction of transgene into intact islets by adenovirus, plasmid, and oligonucleotides often suffers from low efficiency and high toxicity. Low efficiency is especially problematic in gene downregulation studies in intact islets, which require high efficiency. It has been known that enzymatically-dispersed islet cells reaggregate in culture forming spheroids termed pseudoislets. Size-controlled reaggregation of human islet cells creates pseudoislets that maintain dynamic first phase insulin secretion after prolonged culture and provide a window to efficiently introduce lentiviral short hairpin RNA (shRNA) with low toxicity. Here, a detailed protocol for the creation of human pseudoislets after lentiviral transduction using two commercially available multiwell plates is described. The protocol can be easily performed and allows for efficient downregulation of genes and assessment of dynamism of insulin secretion using human islet cells. Thus, human pseudoislets with lentiviral mediated gene modulation provide a powerful and versatile model to assess gene function within human islet cells.

Figure 1:. Process of human pseudoislet preparation.

(a) The suspension containing 4,000 IEQ of human islets becomes cloudy after digestion by a proteolytic and collagenolytic enzyme mixture and mild pipetting. (b) Human islets after dispersion are passed through a strainer. Undigested islets remaining on top of the strainer are dispersed using a 1 mL syringe plunger. (c,d) Microscope images of the single cell suspension containing 3,000 cells/well in a 96-well ultra-low attachment plate before (c) and after (d) centrifugation. (e,f) Microscope images of the single cell suspension containing 500 cells/microwell in a 24-well microwell culture plate before (e) and after (f) centrifugation. Scale bar = 250 μm.

Figure 2:. Morphology of human pseudoislets.

Sequential changes in morphology of human pseudoislets created (a) in a 96-well ultra-low attachment plate from 3,000 cells and (b) in a 24-well microwell culture plate from 500 cells. Scale bar = 100 μm.

Figure 3:. Examples of functional assays using human pseudoislets.

(a) Representative static incubation performed using human pseudoislets created in a microwell culture plate from a single donor at the size of 500 human islet cells per pseudoislet. Four sets of 5 pseudoislets were incubated for 1 h in Krebs-ringer bicarbonate buffer supplemented with either 2 mM or 16.8 mM glucose. Each symbol represents insulin secretion from one set of 5 pseudoislets. Mean ± standard error of the mean (SEM) is shown. *, p < 0.05 by student’s t test. Representative results from three donors. (b) Representative perifusion testing insulin secretion from human pseudoislets created in a microwell culture plate in response to 16.7 mM glucose and 30 mM KCl. Method for perifusion was previously published. Mean ± SEM of insulin secretion from two sets of 40 pseudoislets created in a microwell culture plate from a single donor at the size of 500 human islet cells per pseudoislet plate is shown. Representative data from six donors. (c) Pseudoislets were created with lentivirus carrying shRNA targeting human ATGL (targeting CCTGCCACTCTATGAGCTTAA, left) or PLIN5 (targeting GACAAGCTGGAAGAGAAGCTT, right). Control pseudoislets were transduced with lentivirus expressing scrambled sequence (Scr) previously published. The mRNA expression of each gene was determined by real time polymerase chain reaction (PCR) as previously published. Data were expressed using 2^−DDCT taking peptidylprolyl Isomerase B (PPIB) as an internal control. Each dot represents data from each donor for an indicated primer and a data set from the same donor is connected by a line. N = 3 donors. *; p < 0.05 by student’s t test.