The yeast scavenger decapping enzyme DcpS and its application for in vitro RNA recapping

Abstract

Eukaryotic mRNAs are modified at their 5' end early during transcription by the addition of N7-methylguanosine (m⁷G), which forms the "cap" on the first 5' nucleotide. Identification of the 5' nucleotide on mRNA is necessary for determination of the Transcription Start Site (TSS). We explored the effect of various reaction conditions on the activity of the yeast scavenger mRNA decapping enzyme DcpS and examined decapping of 30 chemically distinct cap structures varying the state of methylation, sugar, phosphate linkage, and base composition on 25mer RNA oligonucleotides. Contrary to the generally accepted belief that DcpS enzymes only decap short oligonucleotides, we found that the yeast scavenger decapping enzyme decaps RNA transcripts as long as 1400 nucleotides. Further, we validated the application of yDcpS for enriching capped RNA using a strategy of specifically tagging the 5' end of capped RNA by first decapping and then recapping it with an affinity-tagged guanosine nucleotide.

Figure 1

Cap structure and site of hydrolysis for the HIT and Nudix enzymes.

Figure 2

Biochemical Assays for DcpS. (a) Conversion of m⁷GpppA dinucleotide to m⁷GMP. A 200 µL reaction in decapping buffer containing 50 µM m⁷GpppA and either 25 nM yDcpS (black □) or 42 nM hDcpS (grey □) was incubated at 37 °C. 20 µL samples were withdrawn at the indicated times. The reactions were terminated by incubation at 70 °C. Picomoles of m⁷GMP product were determined by LC-MS. (b) Decapping of a 25mer Cap 1 RNA by yDcpS. A 30 µL reaction containing 300 ng of total E. coli RNA and 60 ng of 25mer Cap 1 RNA was incubated for 3 hours at 37 °C with 130 ng of yDcpS in 10 mM MES pH 6.5 and 1 mM EDTA. At 0 minutes a 5 µL aliquot was mixed with 2X RNA loading dye stop solution (Lane 1). Likewise 5 µL aliquots were taken at 5, 60, 120, and 180 min (Lanes 2 to 5, respectively). The RNA aliquots were analyzed by 15% TBE-Urea PAGE stained with SYBR Gold. (c) Capillary electrophoresis of 3′-FAM-labeled 5′-capped 25mer RNA. Top panel shows a representative example of the decapping reaction progress. The 25mer Cap 0 RNA was incubated with yDcpS for various times indicated on the left. Bottom panel shows the mobility shift for standards of 25mer RNAs containing different 5′ ends. All data were plotted relative to GeneScan^TM120 LIZ^TM Applied Biosystems standards.

Figure 3

The effect of the secondary structure at the 5′ end of RNA on the decapping activity of yDcpS. Complementary synthetic RNA oligos were annealed to the 3′-FAM-labeled 25mer Cap 0 RNA to create a blunt (○), a 5′ extension (△), or a 5′ recession (□) as depicted on the right. The extent of decapping of each after 60 minutes at 37 °C with various concentrations of yDcpS was determined by capillary electrophoresis. The following complementary sequences were used for blunt, UUGAGCGUACUCGACGAAGUUCUAC; 5′ extension UUGAGCGUACUCGACGAAGU; and 5′ recession, UUGAGCGUACUCGACGAAGUUCUACAAUGACCAUC. The data points are an average of three replicates.

Figure 4

Relative decapping efficiency of yDcpS with 30 different cap structures on 25mer RNAs. (a) chemical representation of cap structures. (b) Composite of gel images of 6 decapping reactions of 25mer RNA substrates (m⁷Gppp⁶mA, m⁷GpppG, m⁷GpppGm, GpppG, m⁷Gppp⁶mAm, m⁷GpppA) incubated with increasing concentrations of yDcpS for 60 minutes at 37 °C. The reactions were electrophoresed on a 15% TBE-Urea gel and stained with SYBR Gold. The full-length gel images are shown in the Supplemental Information. (c) Substrates decapped (greater than 95% at 2.7 µM yDcpS) are shaded in green and substrates resistant to decapping (less than 10% at 25 µM yDcpS) are shaded in pink. Bolded characters indicate canonical cap structures (known or anticipated).

Figure 5

yDcpS decapping of a 25mer Cap1 RNA followed by VCE recapping. A m⁷G-capped 25mer RNA (0.22 μg) was mixed with 1 µg of total E. coli RNA and incubated with 0.1 nmol of yDcpS for 2 h at 37 °C. An aliquot was removed prior to the addition of yDcpS to provide a reference band for m⁷G-capped 25mer (Lane 1). The yDcpS reaction was terminated by addition of Proteinase K and purified using Ampure XP beads. After elution, the RNA was incubated in 1X VCE buffer containing 0.1 mM SAM and 0.5 mM DTB-GTP in the presence (Lane 2) or absence (Lane 3) of VCE for 1 h at 37 °C. All samples were electrophoresed on a 15% TBE-Urea gel and stained with SYBR Gold.

Figure 6

Efficient recovery of long capped RNA transcripts by a decapping/recapping procedure. A mixture of m⁷G-capped RNAs (0.090–1.4 kb) was divided into two samples. One sample was incubated with yDcpS and one without yDcpS, and both were subsequently treated with VCE and DTB-GTP. An equal fraction of each was exposed to streptavidin beads, which were washed and eluted. Lanes 1 (+yDcpS) and 2 (−yDcpS) show the samples after the VCE reaction. Lanes 3 (+yDcpS) and 4 (−yDcpS) show the eluates from streptavidin beads. All lanes represent an equal fraction of the original mixture. Both gel panels are from the same imaged gel.