Molecular mechanism of Forkhead box M1 inhibition by thiostrepton in breast cancer cells

Abstract

Breast cancer is the most common type of malignancies in women worldwide, and genotoxic chemotherapeutic drugs are effective by causing DNA damage in cancer cells. However, >90% of patients with metastatic cancer are resistant to chemotherapy. The Forkhead box M1 (FOXM1) transcription factor plays a pivotal role in the resistance of breast cancer cells to chemotherapy by promoting DNA damage repair following genotoxic drug treatment. The aim of the present study was to investigate the inhibition of the FOXM1 protein by thiostrepton, a natural antibiotic produced by the Streptomyces species. Experimental studies were designed to examine the effectiveness of thiostrepton in downregulating FOXM1 mRNA expression and activity, leading to senescence and apoptosis of breast cancer cells. The cytotoxicity of thiostrepton in breast cancer was determined using cell viability assay. Additionally, thiostrepton treatment decreased the mRNA expression of cyclin B1 (CCNB1), a downstream target of FOXM1. The present results indicated that thiostrepton inhibited FOXM1 mRNA expression and its effect on CCNB1. Molecular dynamic simulations were performed to study the interactions between FOXM1‑DNA and thiostrepton after molecular docking. The results revealed that the possible mechanism underlying the inhibitory effect of thiostrepton on FOXM1 function was by forming a tight complex with the DNA and FOXM1 via its binding domain. Collectively, these results indicated that thiostrepton is a specific and direct inhibitor of the FOXM1 protein in breast cancer. The findings of the present study may lead to the development of novel therapeutic strategies for breast cancer and help overcome resistance to conventional chemotherapeutic drugs.

Figure 1.

Thiostrepton decreases MCF-7 cell viability in dose- and time- dependent manners. MCF-7 cells were treated with two-fold dilutions of thiostrepton at concentrations ranging from 0 to 30 µM for 24 (blue), 48 (green) and 72 (red) h. Cell viability was measured by an MTT assay. Representative data from three independent experiments are presented. Statistical analyses were performed using one-way ANOVA with post hoc Dunnett's test and compared with the control (0 µM). *P<0.05 was considered as statistically significant.

Figure 2.

Thiostrepton treatment at low concentrations induces cellular senescence in MCF-7 cells. SA-β-gal staining of (A) untreated cells, or cells treated with thiostrepton at concentrations of (B) 1 µM, (C) 2 µM and (D) 4 µM for 24 h. The treated cells were stained for SA-β-gal activity (green, SA-β-gal-positive). Red arrows indicate morphological changes in senescent cells. Blue asterisks, morphological changes in dying cells. (E) The percentages of SA-β-gal-positive cells are presented as the mean ± standard deviation. Statistical analyses were performed using one-way ANOVA with post hoc Dunnett's test and compared with the control (0 µM). *P<0.05 was considered as statistically significant. SA-β-gal senescence-associated β-galactosidase.

Figure 3.

Thiostrepton treatment for 24 h downregulates the expression of FOXM1 and its downstream target in MCF-7 cells. The RT-PCR analysis of mRNA expression using the primers detected the isoforms FOXM1c (1,039 bp) and FOXM1b (996 bp). Cyclin B1 and FOXM1 (auto-regulated) were the main downstream targets of the FOXM1 protein, and ACTB served as the internal control. CCNB1, cyclin B1; ACTB, β-actin; FOXM1, Forkhead box M1.

Figure 4.

Different modes of thiostrepton binding to FOXM1 (golden bronze) with different models: (A) Monomer FOXM1, (B) dimer FOXM1 and (C) FOXM1-DNA complex. The lowest binding energy of thiostrepton was found in mode 1 (red), followed by mode 2 (green), 3 (cyan), 4 (pink), 5 (purple), 6 (orange), 7 (sea blue-green), 8 (magenta) and 9 (yellow). Blue circles, different possible positions of binding area. FOXM1, Forkhead box M1.

Figure 5.

The RMSF of the DNA-A chain forms a complex with the FOXM1 dimer. The systems with and without thiostrepton in the DNA-A-binding domain are represented in red and black lines, respectively. Inset shows the RMSF in specific binding residues of Thy9, Ade10 and Thy11 of the DNA-A chain. The numbers 9, 10 and 11 refer to the order of base-paired sequence in the DNA-A chain. RMSF, root-mean-square fluctuation; FOXM1, Forkhead box M1.

Figure 6.

(A) The final structure at 200 nsec of the system containing FOXM1-DNA with thiostrepton (red). The FOXM1 dimers are represented in golden bronze. DNA double-strand target consists of the DNA-A chain [AAATTGTTTATAAACAGCCCG] and the DNA-B chain [TTCGGGCTGTTTATAAACAAT], presented in white. (B) Thy9 and Thy11 in DNA-A formed hydrogen bonds with thiostrepton. (C) Four hydrogen bonds were found between the residues of FOXM1 and DNA-A inside the DNA-binding domain. FOXM1, Forkhead box M1.